Incidental Mutation 'R9487:Dsc2'
ID 716713
Institutional Source Beutler Lab
Gene Symbol Dsc2
Ensembl Gene ENSMUSG00000024331
Gene Name desmocollin 2
Synonyms Dsc2a, Dsc2b
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9487 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 20163690-20192611 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20180276 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 159 (I159N)
Ref Sequence ENSEMBL: ENSMUSP00000042905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]
AlphaFold P55292
Predicted Effect probably damaging
Transcript: ENSMUST00000039247
AA Change: I159N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: I159N

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075214
AA Change: I159N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: I159N

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:Cadherin_C 730 901 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128464
SMART Domains Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik C T 1: 53,221,665 (GRCm39) D55N possibly damaging Het
Abcc2 G A 19: 43,806,471 (GRCm39) G762S probably damaging Het
Acta2 C A 19: 34,225,865 (GRCm39) A110S probably damaging Het
Adam26a T C 8: 44,022,456 (GRCm39) T345A possibly damaging Het
Anapc11 T C 11: 120,496,250 (GRCm39) *85R probably null Het
Ang2 A C 14: 51,433,071 (GRCm39) C104G probably damaging Het
Ankzf1 G A 1: 75,174,596 (GRCm39) V529I probably benign Het
Aox4 G T 1: 58,288,097 (GRCm39) V737F probably benign Het
Aqr T C 2: 113,934,528 (GRCm39) N1371S probably benign Het
Bach1 T A 16: 87,526,733 (GRCm39) S732T probably benign Het
Bcr T A 10: 74,967,431 (GRCm39) I555N probably damaging Het
Bicra T C 7: 15,705,717 (GRCm39) T1575A probably damaging Het
Bop1 A G 15: 76,338,076 (GRCm39) L598P probably damaging Het
Cacna1d A T 14: 29,845,419 (GRCm39) F605L possibly damaging Het
Capn15 C T 17: 26,184,353 (GRCm39) V109I possibly damaging Het
Cdkn1b T C 6: 134,897,815 (GRCm39) probably benign Het
Dnah2 T C 11: 69,406,617 (GRCm39) T542A possibly damaging Het
Ecel1 A T 1: 87,075,716 (GRCm39) V774E probably damaging Het
Eif5b T G 1: 38,084,560 (GRCm39) C849W probably damaging Het
Eif5b T A 1: 38,058,451 (GRCm39) L251* probably null Het
Ext2 T C 2: 93,592,956 (GRCm39) D416G probably damaging Het
Fancm G A 12: 65,153,388 (GRCm39) W1281* probably null Het
Flvcr1 A T 1: 190,743,829 (GRCm39) I409K possibly damaging Het
Foxk1 T C 5: 142,437,389 (GRCm39) probably null Het
Frem2 T A 3: 53,560,905 (GRCm39) I1201F possibly damaging Het
Gabra5 A G 7: 57,157,873 (GRCm39) probably benign Het
Gmpr2 G A 14: 55,915,778 (GRCm39) V319I probably damaging Het
Gna12 A T 5: 140,746,338 (GRCm39) L369Q probably damaging Het
Gpr160 A G 3: 30,950,914 (GRCm39) R329G probably benign Het
H2-M10.3 T C 17: 36,677,423 (GRCm39) H285R probably benign Het
H2-M2 A T 17: 37,793,424 (GRCm39) V194E probably benign Het
Hephl1 G A 9: 14,995,830 (GRCm39) R431W possibly damaging Het
Hr A G 14: 70,793,877 (GRCm39) T46A probably benign Het
Hr A G 14: 70,794,205 (GRCm39) H126R possibly damaging Het
Hsf1 T G 15: 76,382,398 (GRCm39) D256E probably benign Het
Ifi208 C T 1: 173,510,961 (GRCm39) T372I probably damaging Het
Ifi47 T G 11: 48,986,620 (GRCm39) F129C probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,366,470 (GRCm39) probably benign Het
Irag2 A G 6: 145,120,257 (GRCm39) I491V probably benign Het
Itga11 A T 9: 62,670,171 (GRCm39) N765I probably benign Het
Klhl22 T A 16: 17,589,663 (GRCm39) I108K probably benign Het
Lancl1 T G 1: 67,073,381 (GRCm39) H34P probably benign Het
Lcor C A 19: 41,573,685 (GRCm39) N813K probably damaging Het
Mbd3l1 G A 9: 18,396,274 (GRCm39) G133D probably benign Het
Med12l T C 3: 59,155,353 (GRCm39) F1178L probably benign Het
Mrm1 A T 11: 84,705,531 (GRCm39) N289K probably damaging Het
Myf6 A G 10: 107,330,073 (GRCm39) Y165H probably benign Het
Myo1g C A 11: 6,456,913 (GRCm39) C971F probably benign Het
Myo3a T C 2: 22,245,862 (GRCm39) M3T probably benign Het
Nsrp1 G A 11: 76,937,114 (GRCm39) R361* probably null Het
Or10d4 A C 9: 39,580,611 (GRCm39) Q86P possibly damaging Het
Or10h1b C A 17: 33,395,548 (GRCm39) H57Q possibly damaging Het
Or4a69 T C 2: 89,312,756 (GRCm39) H241R probably damaging Het
Or4a77 T C 2: 89,487,731 (GRCm39) D18G probably damaging Het
Or5p6 A T 7: 107,631,163 (GRCm39) I129N possibly damaging Het
Or8b41 G A 9: 38,054,866 (GRCm39) C140Y probably benign Het
Or8k53 T A 2: 86,177,846 (GRCm39) D88V probably benign Het
Oscar T G 7: 3,614,663 (GRCm39) Y103S probably damaging Het
Pdpr A G 8: 111,852,925 (GRCm39) N610S probably benign Het
Ppp4r3b T C 11: 29,124,697 (GRCm39) I56T probably damaging Het
Pxdn T A 12: 30,044,552 (GRCm39) V510D possibly damaging Het
Rab11fip5 T C 6: 85,324,913 (GRCm39) S465G possibly damaging Het
Rasgrf2 T C 13: 92,267,759 (GRCm39) T82A probably benign Het
Scmh1 G A 4: 120,320,284 (GRCm39) W30* probably null Het
Sema4g T C 19: 44,981,071 (GRCm39) Y40H probably benign Het
Serpinf2 A T 11: 75,323,494 (GRCm39) M404K probably damaging Het
Sgk3 T C 1: 9,950,616 (GRCm39) probably null Het
Slc16a5 A T 11: 115,360,738 (GRCm39) Y307F possibly damaging Het
Slc39a5 G A 10: 128,233,628 (GRCm39) L290F probably damaging Het
Snx32 A C 19: 5,547,736 (GRCm39) D191E probably damaging Het
Sp4 T C 12: 118,262,859 (GRCm39) I396V probably benign Het
Srrd A G 5: 112,490,765 (GRCm39) V42A unknown Het
Stim1 A G 7: 102,080,257 (GRCm39) H547R unknown Het
Svep1 G A 4: 58,070,517 (GRCm39) A2423V probably benign Het
Tep1 A G 14: 51,066,687 (GRCm39) S2304P possibly damaging Het
Tkt C G 14: 30,281,795 (GRCm39) S104R probably benign Het
Tkt T C 14: 30,281,796 (GRCm39) S105P probably damaging Het
Tln1 A T 4: 43,542,893 (GRCm39) N1365K probably damaging Het
Topaz1 G T 9: 122,604,707 (GRCm39) A1104S probably benign Het
Trmt2a A G 16: 18,068,814 (GRCm39) H270R probably damaging Het
Ttll10 G T 4: 156,127,616 (GRCm39) T389K probably benign Het
Tubal3 A G 13: 3,980,674 (GRCm39) I129V probably benign Het
Ucp3 A G 7: 100,131,123 (GRCm39) E192G probably damaging Het
Usp47 A G 7: 111,677,063 (GRCm39) D448G probably damaging Het
Vmn2r98 T A 17: 19,301,496 (GRCm39) L833M possibly damaging Het
Vps13d A G 4: 144,807,869 (GRCm39) probably null Het
Wdr7 A G 18: 63,910,939 (GRCm39) D777G possibly damaging Het
Zcchc8 A G 5: 123,847,300 (GRCm39) I213T probably damaging Het
Zfp281 T C 1: 136,555,143 (GRCm39) I707T probably damaging Het
Zfp335 T C 2: 164,735,395 (GRCm39) H1158R probably damaging Het
Zfp692 C T 11: 58,199,765 (GRCm39) T118M probably damaging Het
Zfr2 T A 10: 81,075,969 (GRCm39) L192Q probably benign Het
Other mutations in Dsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Dsc2 APN 18 20,174,854 (GRCm39) missense probably benign 0.01
IGL00826:Dsc2 APN 18 20,168,372 (GRCm39) missense probably damaging 1.00
IGL00852:Dsc2 APN 18 20,167,740 (GRCm39) missense probably benign 0.01
IGL01082:Dsc2 APN 18 20,176,849 (GRCm39) missense probably damaging 1.00
IGL01328:Dsc2 APN 18 20,181,343 (GRCm39) missense probably damaging 0.98
IGL01338:Dsc2 APN 18 20,180,214 (GRCm39) missense probably benign 0.19
IGL01727:Dsc2 APN 18 20,171,257 (GRCm39) missense probably benign 0.01
IGL01766:Dsc2 APN 18 20,179,399 (GRCm39) missense possibly damaging 0.56
IGL02228:Dsc2 APN 18 20,176,790 (GRCm39) missense probably damaging 0.99
IGL02560:Dsc2 APN 18 20,178,596 (GRCm39) missense probably damaging 1.00
IGL02794:Dsc2 APN 18 20,174,788 (GRCm39) missense probably damaging 1.00
3-1:Dsc2 UTSW 18 20,180,136 (GRCm39) missense possibly damaging 0.60
PIT4305001:Dsc2 UTSW 18 20,179,300 (GRCm39) missense probably damaging 0.96
PIT4431001:Dsc2 UTSW 18 20,179,334 (GRCm39) nonsense probably null
R0288:Dsc2 UTSW 18 20,166,177 (GRCm39) missense probably damaging 1.00
R0542:Dsc2 UTSW 18 20,184,283 (GRCm39) missense probably damaging 0.99
R0562:Dsc2 UTSW 18 20,174,594 (GRCm39) missense probably damaging 0.99
R0697:Dsc2 UTSW 18 20,174,509 (GRCm39) missense probably damaging 0.99
R0940:Dsc2 UTSW 18 20,183,116 (GRCm39) missense probably damaging 0.97
R1081:Dsc2 UTSW 18 20,166,352 (GRCm39) missense probably damaging 0.96
R1140:Dsc2 UTSW 18 20,165,269 (GRCm39) missense probably damaging 1.00
R1515:Dsc2 UTSW 18 20,178,622 (GRCm39) missense probably benign 0.40
R1515:Dsc2 UTSW 18 20,167,758 (GRCm39) missense probably damaging 0.99
R1558:Dsc2 UTSW 18 20,183,208 (GRCm39) missense probably damaging 0.99
R1654:Dsc2 UTSW 18 20,179,303 (GRCm39) missense probably benign 0.01
R2061:Dsc2 UTSW 18 20,165,456 (GRCm39) missense possibly damaging 0.79
R2089:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2172:Dsc2 UTSW 18 20,178,559 (GRCm39) missense probably damaging 1.00
R2247:Dsc2 UTSW 18 20,168,369 (GRCm39) missense probably damaging 1.00
R2472:Dsc2 UTSW 18 20,178,526 (GRCm39) missense probably benign 0.00
R2927:Dsc2 UTSW 18 20,178,558 (GRCm39) missense probably damaging 1.00
R3611:Dsc2 UTSW 18 20,165,408 (GRCm39) missense probably damaging 0.99
R3961:Dsc2 UTSW 18 20,184,284 (GRCm39) missense probably damaging 0.98
R3963:Dsc2 UTSW 18 20,184,284 (GRCm39) missense probably damaging 0.98
R4353:Dsc2 UTSW 18 20,183,125 (GRCm39) missense probably damaging 1.00
R4362:Dsc2 UTSW 18 20,183,214 (GRCm39) missense probably damaging 1.00
R4612:Dsc2 UTSW 18 20,174,876 (GRCm39) missense probably damaging 1.00
R4613:Dsc2 UTSW 18 20,174,876 (GRCm39) missense probably damaging 1.00
R4752:Dsc2 UTSW 18 20,171,279 (GRCm39) missense probably damaging 1.00
R4946:Dsc2 UTSW 18 20,183,214 (GRCm39) missense probably damaging 1.00
R5056:Dsc2 UTSW 18 20,183,199 (GRCm39) missense probably damaging 1.00
R5267:Dsc2 UTSW 18 20,167,640 (GRCm39) critical splice donor site probably null
R5445:Dsc2 UTSW 18 20,168,360 (GRCm39) missense possibly damaging 0.76
R5507:Dsc2 UTSW 18 20,179,336 (GRCm39) missense probably damaging 0.96
R5575:Dsc2 UTSW 18 20,168,447 (GRCm39) missense probably damaging 1.00
R5781:Dsc2 UTSW 18 20,165,567 (GRCm39) missense probably benign 0.00
R6102:Dsc2 UTSW 18 20,180,165 (GRCm39) missense probably benign 0.01
R6129:Dsc2 UTSW 18 20,178,487 (GRCm39) missense possibly damaging 0.95
R6362:Dsc2 UTSW 18 20,168,520 (GRCm39) nonsense probably null
R6433:Dsc2 UTSW 18 20,184,232 (GRCm39) critical splice donor site probably null
R6513:Dsc2 UTSW 18 20,179,295 (GRCm39) missense probably benign
R6615:Dsc2 UTSW 18 20,165,576 (GRCm39) missense possibly damaging 0.88
R6619:Dsc2 UTSW 18 20,165,335 (GRCm39) missense probably benign 0.22
R6665:Dsc2 UTSW 18 20,183,205 (GRCm39) missense probably damaging 1.00
R6961:Dsc2 UTSW 18 20,171,279 (GRCm39) missense probably damaging 1.00
R7179:Dsc2 UTSW 18 20,168,332 (GRCm39) critical splice donor site probably null
R7275:Dsc2 UTSW 18 20,184,236 (GRCm39) nonsense probably null
R7352:Dsc2 UTSW 18 20,168,392 (GRCm39) missense probably benign 0.39
R7386:Dsc2 UTSW 18 20,174,983 (GRCm39) missense possibly damaging 0.84
R7496:Dsc2 UTSW 18 20,168,451 (GRCm39) nonsense probably null
R7510:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R7580:Dsc2 UTSW 18 20,183,130 (GRCm39) missense probably damaging 1.00
R7718:Dsc2 UTSW 18 20,174,835 (GRCm39) missense probably damaging 0.98
R7733:Dsc2 UTSW 18 20,181,373 (GRCm39) missense probably benign 0.16
R7733:Dsc2 UTSW 18 20,181,372 (GRCm39) missense probably benign 0.00
R7818:Dsc2 UTSW 18 20,183,189 (GRCm39) missense probably damaging 1.00
R7852:Dsc2 UTSW 18 20,179,342 (GRCm39) missense possibly damaging 0.67
R7998:Dsc2 UTSW 18 20,167,720 (GRCm39) missense possibly damaging 0.87
R8029:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8030:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8031:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8032:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8059:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8060:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8061:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8062:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8063:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8082:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8090:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8114:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8115:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8116:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8117:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8118:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8328:Dsc2 UTSW 18 20,165,576 (GRCm39) missense possibly damaging 0.68
R8545:Dsc2 UTSW 18 20,167,722 (GRCm39) nonsense probably null
R9005:Dsc2 UTSW 18 20,171,151 (GRCm39) missense probably benign 0.00
R9017:Dsc2 UTSW 18 20,176,968 (GRCm39) missense probably damaging 1.00
R9111:Dsc2 UTSW 18 20,167,764 (GRCm39) missense probably benign 0.00
R9396:Dsc2 UTSW 18 20,174,773 (GRCm39) nonsense probably null
R9663:Dsc2 UTSW 18 20,171,205 (GRCm39) missense probably damaging 1.00
Z1088:Dsc2 UTSW 18 20,179,361 (GRCm39) missense probably damaging 0.98
Z1176:Dsc2 UTSW 18 20,168,356 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATCTTCAGACGTTACCTCAAAG -3'
(R):5'- TACAGAGAAGTCCCAAGTGTTTG -3'

Sequencing Primer
(F):5'- GGACTCATACTGCTCACGATC -3'
(R):5'- GCTTCTATGGGATTTTGCAAGTATC -3'
Posted On 2022-07-18