Incidental Mutation 'R9488:Clca4a'
ID 716737
Institutional Source Beutler Lab
Gene Symbol Clca4a
Ensembl Gene ENSMUSG00000068547
Gene Name chloride channel accessory 4A
Synonyms Clca6, 9130020L07Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock # R9488 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 144952480-144975045 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144953771 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 775 (T775A)
Ref Sequence ENSEMBL: ENSMUSP00000029923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029923]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000029923
AA Change: T775A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029923
Gene: ENSMUSG00000068547
AA Change: T775A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 286 300 N/A INTRINSIC
VWA 306 480 5.94e-16 SMART
Blast:VWA 513 552 7e-18 BLAST
Blast:FN3 757 838 8e-33 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik A G 4: 10,893,271 D130G probably damaging Het
4930433I11Rik A T 7: 40,993,788 I294L probably benign Het
Ankrd35 A T 3: 96,682,027 K187N probably damaging Het
Arhgap40 C T 2: 158,549,651 T631M possibly damaging Het
Arpin T C 7: 79,935,231 Y5C probably damaging Het
B020011L13Rik A G 1: 117,800,994 Y77C Het
Cdk17 A G 10: 93,208,204 K2E probably damaging Het
Cdk18 A G 1: 132,121,522 F86L probably benign Het
Clvs2 T A 10: 33,513,305 D313V possibly damaging Het
Col6a5 T C 9: 105,864,589 Y2377C probably damaging Het
Drd2 T C 9: 49,399,794 V115A probably damaging Het
Dsp A G 13: 38,193,242 R1668G probably benign Het
Eif2d T A 1: 131,155,225 V102E probably damaging Het
Fam205a1 A G 4: 42,850,560 V532A probably benign Het
Fmo4 A G 1: 162,803,768 V210A probably damaging Het
Galntl5 A G 5: 25,210,439 R323G probably damaging Het
Git2 T C 5: 114,766,472 T129A probably benign Het
Gm14124 G A 2: 150,268,557 G389D unknown Het
Gm572 A G 4: 148,668,456 H264R possibly damaging Het
Hnrnpll T C 17: 80,061,956 T13A unknown Het
Ighv7-4 T C 12: 114,222,999 Y51C probably damaging Het
Jam2 A G 16: 84,822,788 D289G probably damaging Het
Krt27 A G 11: 99,348,709 probably null Het
Lama5 T C 2: 180,181,441 N2704S possibly damaging Het
Lhx8 A T 3: 154,328,127 S70T possibly damaging Het
Lmo7 C A 14: 101,885,347 T324N possibly damaging Het
Lrmp G A 6: 145,168,027 R307Q probably damaging Het
Man2a1 A G 17: 64,733,739 T907A possibly damaging Het
Map3k4 C T 17: 12,270,973 A524T probably damaging Het
Mga C T 2: 119,964,823 A2996V possibly damaging Het
Mybpc1 A T 10: 88,543,762 M625K possibly damaging Het
Ncald T A 15: 37,372,125 N159Y probably damaging Het
Nfasc T C 1: 132,600,128 T832A possibly damaging Het
P2rx5 T A 11: 73,165,601 I117N Het
Pcdhb3 C A 18: 37,302,363 R461S possibly damaging Het
Polr1b T C 2: 129,125,497 S937P probably damaging Het
Prep C A 10: 45,120,711 Q362K Het
Prg4 T C 1: 150,451,273 M342V probably benign Het
Prr14 A T 7: 127,474,515 T184S possibly damaging Het
Prss58 A G 6: 40,897,448 I98T probably benign Het
Pum3 T C 19: 27,416,788 T361A probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,922 probably benign Het
Sema4c A G 1: 36,551,986 V424A probably benign Het
Sema6a A T 18: 47,304,149 I58N probably damaging Het
Slc13a3 T A 2: 165,408,931 Y506F probably damaging Het
Slc15a2 A G 16: 36,759,289 V365A probably benign Het
Slc39a5 G A 10: 128,397,759 L290F probably damaging Het
Taf6l T C 19: 8,782,072 T161A probably benign Het
Tbl2 T A 5: 135,158,617 C243S probably benign Het
Tet2 A T 3: 133,487,342 S444T probably benign Het
Thoc1 C T 18: 9,992,168 L499F probably damaging Het
Tnc A G 4: 63,995,705 V1290A probably damaging Het
Tnpo1 T C 13: 98,853,495 D716G probably damaging Het
Tpp2 A T 1: 44,002,112 K1236N probably benign Het
Tshr T C 12: 91,537,815 V509A probably damaging Het
U2surp T C 9: 95,474,482 T775A Het
Ubap2l T C 3: 90,021,349 T486A probably benign Het
Usp28 C A 9: 49,023,988 P457T probably damaging Het
Usp44 A G 10: 93,846,989 I387V possibly damaging Het
Vmn1r225 A G 17: 20,502,531 D78G probably damaging Het
Vps13b T C 15: 35,447,734 M537T possibly damaging Het
Wdr6 G A 9: 108,575,983 R234C probably damaging Het
Zfp949 C A 9: 88,570,129 T584N probably benign Het
Other mutations in Clca4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Clca4a APN 3 144954939 missense probably damaging 0.99
IGL01139:Clca4a APN 3 144966269 missense probably damaging 0.99
IGL01371:Clca4a APN 3 144960672 missense probably damaging 1.00
IGL01609:Clca4a APN 3 144953780 missense probably damaging 1.00
IGL01998:Clca4a APN 3 144958126 missense probably damaging 0.98
IGL02172:Clca4a APN 3 144970394 nonsense probably null
IGL02217:Clca4a APN 3 144961996 missense possibly damaging 0.61
IGL02514:Clca4a APN 3 144955071 missense probably damaging 1.00
IGL02975:Clca4a APN 3 144963769 missense possibly damaging 0.90
IGL03025:Clca4a APN 3 144957318 missense probably benign 0.07
IGL03049:Clca4a APN 3 144970755 splice site probably benign
IGL03058:Clca4a APN 3 144961834 splice site probably benign
IGL03259:Clca4a APN 3 144958080 missense probably damaging 1.00
IGL03263:Clca4a APN 3 144966431 missense probably damaging 1.00
IGL03334:Clca4a APN 3 144953866 missense probably benign 0.28
PIT4142001:Clca4a UTSW 3 144968311 missense probably damaging 1.00
R0201:Clca4a UTSW 3 144960717 missense probably benign 0.00
R0316:Clca4a UTSW 3 144953764 missense probably damaging 1.00
R0524:Clca4a UTSW 3 144969393 missense probably damaging 1.00
R0680:Clca4a UTSW 3 144969367 missense probably damaging 1.00
R0688:Clca4a UTSW 3 144961974 missense probably damaging 1.00
R1137:Clca4a UTSW 3 144970685 missense probably damaging 1.00
R1568:Clca4a UTSW 3 144952929 missense probably benign 0.00
R1719:Clca4a UTSW 3 144963755 missense probably damaging 1.00
R2055:Clca4a UTSW 3 144970728 missense probably damaging 1.00
R3078:Clca4a UTSW 3 144968253 missense probably damaging 0.99
R3080:Clca4a UTSW 3 144963790 missense probably damaging 1.00
R3789:Clca4a UTSW 3 144974956 missense probably damaging 1.00
R3881:Clca4a UTSW 3 144957318 missense probably benign 0.07
R4133:Clca4a UTSW 3 144969352 missense probably benign 0.07
R4402:Clca4a UTSW 3 144952848 missense probably benign 0.08
R4455:Clca4a UTSW 3 144957259 missense probably damaging 1.00
R4577:Clca4a UTSW 3 144954969 missense probably damaging 0.97
R4683:Clca4a UTSW 3 144954940 missense probably damaging 1.00
R5135:Clca4a UTSW 3 144954946 missense probably damaging 1.00
R5267:Clca4a UTSW 3 144953812 missense probably damaging 1.00
R5345:Clca4a UTSW 3 144970461 missense probably damaging 1.00
R6311:Clca4a UTSW 3 144966413 missense probably damaging 0.99
R6492:Clca4a UTSW 3 144957298 missense probably benign 0.00
R6493:Clca4a UTSW 3 144957298 missense probably benign 0.00
R6494:Clca4a UTSW 3 144957298 missense probably benign 0.00
R6861:Clca4a UTSW 3 144970655 missense probably benign
R7102:Clca4a UTSW 3 144961909 missense probably benign 0.01
R7133:Clca4a UTSW 3 144961890 nonsense probably null
R7171:Clca4a UTSW 3 144958173 missense probably benign
R7516:Clca4a UTSW 3 144966248 missense probably damaging 1.00
R7642:Clca4a UTSW 3 144953751 missense probably benign 0.11
R7731:Clca4a UTSW 3 144952785 missense probably benign 0.02
R7787:Clca4a UTSW 3 144953833 missense probably benign
R7820:Clca4a UTSW 3 144960671 missense probably damaging 1.00
R7895:Clca4a UTSW 3 144968405 missense probably benign 0.19
R7991:Clca4a UTSW 3 144952739 missense possibly damaging 0.75
R8240:Clca4a UTSW 3 144970727 missense probably damaging 1.00
R9308:Clca4a UTSW 3 144970422 missense probably damaging 1.00
R9373:Clca4a UTSW 3 144966372 missense possibly damaging 0.66
R9772:Clca4a UTSW 3 144970661 missense probably damaging 1.00
R9781:Clca4a UTSW 3 144961952 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTTTAAAAGACAGCTATGCAGGG -3'
(R):5'- AGAAAGCTGACTGACTGAGTTC -3'

Sequencing Primer
(F):5'- GGGAAAGTAAGACCTGTTTCATAAC -3'
(R):5'- AGCTGACTGACTGAGTTCTATAAAG -3'
Posted On 2022-07-18