Incidental Mutation 'R9488:Usp44'
ID 716762
Institutional Source Beutler Lab
Gene Symbol Usp44
Ensembl Gene ENSMUSG00000020020
Gene Name ubiquitin specific peptidase 44
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9488 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 93831555-93858088 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 93846989 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 387 (I387V)
Ref Sequence ENSEMBL: ENSMUSP00000092975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095333] [ENSMUST00000216224]
AlphaFold Q8C2S0
Predicted Effect possibly damaging
Transcript: ENSMUST00000095333
AA Change: I387V

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092975
Gene: ENSMUSG00000020020
AA Change: I387V

DomainStartEndE-ValueType
Pfam:zf-UBP 26 88 5.4e-23 PFAM
Pfam:UCH 161 480 3.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216224
AA Change: I434V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease that functions as a deubiquitinating enzyme. The encoded protein is thought to help regulate the spindle assembly checkpoint by preventing early anaphase onset. This protein specifically deubiquitinates CDC20, which stabilizes the anaphase promoting complex/cyclosome. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit chromosomal instability, aneuploidy and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik A G 4: 10,893,271 D130G probably damaging Het
4930433I11Rik A T 7: 40,993,788 I294L probably benign Het
Ankrd35 A T 3: 96,682,027 K187N probably damaging Het
Arhgap40 C T 2: 158,549,651 T631M possibly damaging Het
Arpin T C 7: 79,935,231 Y5C probably damaging Het
B020011L13Rik A G 1: 117,800,994 Y77C Het
Cdk17 A G 10: 93,208,204 K2E probably damaging Het
Cdk18 A G 1: 132,121,522 F86L probably benign Het
Clca4a T C 3: 144,953,771 T775A probably damaging Het
Clvs2 T A 10: 33,513,305 D313V possibly damaging Het
Col6a5 T C 9: 105,864,589 Y2377C probably damaging Het
Drd2 T C 9: 49,399,794 V115A probably damaging Het
Dsp A G 13: 38,193,242 R1668G probably benign Het
Eif2d T A 1: 131,155,225 V102E probably damaging Het
Fam205a1 A G 4: 42,850,560 V532A probably benign Het
Fmo4 A G 1: 162,803,768 V210A probably damaging Het
Galntl5 A G 5: 25,210,439 R323G probably damaging Het
Git2 T C 5: 114,766,472 T129A probably benign Het
Gm14124 G A 2: 150,268,557 G389D unknown Het
Gm572 A G 4: 148,668,456 H264R possibly damaging Het
Hnrnpll T C 17: 80,061,956 T13A unknown Het
Ighv7-4 T C 12: 114,222,999 Y51C probably damaging Het
Jam2 A G 16: 84,822,788 D289G probably damaging Het
Krt27 A G 11: 99,348,709 probably null Het
Lama5 T C 2: 180,181,441 N2704S possibly damaging Het
Lhx8 A T 3: 154,328,127 S70T possibly damaging Het
Lmo7 C A 14: 101,885,347 T324N possibly damaging Het
Lrmp G A 6: 145,168,027 R307Q probably damaging Het
Man2a1 A G 17: 64,733,739 T907A possibly damaging Het
Map3k4 C T 17: 12,270,973 A524T probably damaging Het
Mga C T 2: 119,964,823 A2996V possibly damaging Het
Mybpc1 A T 10: 88,543,762 M625K possibly damaging Het
Ncald T A 15: 37,372,125 N159Y probably damaging Het
Nfasc T C 1: 132,600,128 T832A possibly damaging Het
P2rx5 T A 11: 73,165,601 I117N Het
Pcdhb3 C A 18: 37,302,363 R461S possibly damaging Het
Polr1b T C 2: 129,125,497 S937P probably damaging Het
Prep C A 10: 45,120,711 Q362K Het
Prg4 T C 1: 150,451,273 M342V probably benign Het
Prr14 A T 7: 127,474,515 T184S possibly damaging Het
Prss58 A G 6: 40,897,448 I98T probably benign Het
Pum3 T C 19: 27,416,788 T361A probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,922 probably benign Het
Sema4c A G 1: 36,551,986 V424A probably benign Het
Sema6a A T 18: 47,304,149 I58N probably damaging Het
Slc13a3 T A 2: 165,408,931 Y506F probably damaging Het
Slc15a2 A G 16: 36,759,289 V365A probably benign Het
Slc39a5 G A 10: 128,397,759 L290F probably damaging Het
Taf6l T C 19: 8,782,072 T161A probably benign Het
Tbl2 T A 5: 135,158,617 C243S probably benign Het
Tet2 A T 3: 133,487,342 S444T probably benign Het
Thoc1 C T 18: 9,992,168 L499F probably damaging Het
Tnc A G 4: 63,995,705 V1290A probably damaging Het
Tnpo1 T C 13: 98,853,495 D716G probably damaging Het
Tpp2 A T 1: 44,002,112 K1236N probably benign Het
Tshr T C 12: 91,537,815 V509A probably damaging Het
U2surp T C 9: 95,474,482 T775A Het
Ubap2l T C 3: 90,021,349 T486A probably benign Het
Usp28 C A 9: 49,023,988 P457T probably damaging Het
Vmn1r225 A G 17: 20,502,531 D78G probably damaging Het
Vps13b T C 15: 35,447,734 M537T possibly damaging Het
Wdr6 G A 9: 108,575,983 R234C probably damaging Het
Zfp949 C A 9: 88,570,129 T584N probably benign Het
Other mutations in Usp44
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4378001:Usp44 UTSW 10 93845655 start gained probably benign
R0497:Usp44 UTSW 10 93846806 missense possibly damaging 0.77
R0789:Usp44 UTSW 10 93847220 intron probably benign
R1521:Usp44 UTSW 10 93847186 nonsense probably null
R4032:Usp44 UTSW 10 93847265 intron probably benign
R4212:Usp44 UTSW 10 93846770 missense possibly damaging 0.55
R4755:Usp44 UTSW 10 93846906 missense probably damaging 1.00
R4764:Usp44 UTSW 10 93846071 missense probably benign 0.17
R5095:Usp44 UTSW 10 93846845 missense possibly damaging 0.70
R5775:Usp44 UTSW 10 93845978 missense possibly damaging 0.80
R6029:Usp44 UTSW 10 93846632 missense probably damaging 0.96
R6193:Usp44 UTSW 10 93847148 intron probably benign
R6233:Usp44 UTSW 10 93850340 missense probably damaging 1.00
R6338:Usp44 UTSW 10 93846513 missense probably damaging 1.00
R6374:Usp44 UTSW 10 93856310 missense probably benign 0.12
R6556:Usp44 UTSW 10 93846008 missense probably benign 0.20
R6615:Usp44 UTSW 10 93846489 missense possibly damaging 0.48
R7099:Usp44 UTSW 10 93850187 missense possibly damaging 0.95
R7224:Usp44 UTSW 10 93845993 missense probably benign 0.08
R7361:Usp44 UTSW 10 93846468 missense probably benign 0.00
R7576:Usp44 UTSW 10 93846428 missense probably damaging 0.99
R8014:Usp44 UTSW 10 93852709 critical splice acceptor site probably null
R8695:Usp44 UTSW 10 93846503 missense probably damaging 1.00
R8919:Usp44 UTSW 10 93857913 missense probably benign 0.00
R8950:Usp44 UTSW 10 93846267 missense possibly damaging 0.93
R9144:Usp44 UTSW 10 93845783 missense probably benign 0.09
R9254:Usp44 UTSW 10 93852773 missense possibly damaging 0.93
R9379:Usp44 UTSW 10 93852773 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTATTCAGCCAAGGGAGCCC -3'
(R):5'- ATACAGAATACCCAGTTGTAGGC -3'

Sequencing Primer
(F):5'- AGCCCAGTTCCCCGTACAG -3'
(R):5'- TAGGCCGCACTGTAGGAATTGC -3'
Posted On 2022-07-18