Incidental Mutation 'R9489:Kif9'
ID 716837
Institutional Source Beutler Lab
Gene Symbol Kif9
Ensembl Gene ENSMUSG00000032489
Gene Name kinesin family member 9
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R9489 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 110306062-110354242 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 110346710 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 616 (R616H)
Ref Sequence ENSEMBL: ENSMUSP00000057896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061155] [ENSMUST00000084952] [ENSMUST00000197248] [ENSMUST00000198043]
AlphaFold Q9WV04
Predicted Effect probably benign
Transcript: ENSMUST00000061155
AA Change: R616H

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000057896
Gene: ENSMUSG00000032489
AA Change: R616H

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084952
AA Change: R616H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000082016
Gene: ENSMUSG00000032489
AA Change: R616H

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197248
AA Change: R616H

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000142734
Gene: ENSMUSG00000032489
AA Change: R616H

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 6e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198043
SMART Domains Protein: ENSMUSP00000142689
Gene: ENSMUSG00000032489

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 476 5e-14 BLAST
low complexity region 489 501 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik T A 13: 61,002,683 (GRCm39) S24C probably damaging Het
6430548M08Rik G A 8: 120,872,380 (GRCm39) V103I possibly damaging Het
Acaca C T 11: 84,183,842 (GRCm39) T1240I probably benign Het
Adam19 T C 11: 46,028,449 (GRCm39) V694A probably benign Het
Adipor1 A G 1: 134,352,553 (GRCm39) D108G probably damaging Het
Arhgef4 A G 1: 34,761,745 (GRCm39) T334A unknown Het
Bcl11a T C 11: 24,114,582 (GRCm39) F642L probably benign Het
Camk2d T C 3: 126,561,209 (GRCm39) Y108H probably damaging Het
Castor2 G T 5: 134,164,536 (GRCm39) V166L probably benign Het
Catsper1 A G 19: 5,387,785 (GRCm39) T355A probably benign Het
Ccdc69 T A 11: 54,945,856 (GRCm39) N50I possibly damaging Het
Chd8 A T 14: 52,457,055 (GRCm39) L971Q probably damaging Het
Chrna10 C A 7: 101,762,801 (GRCm39) A130S probably benign Het
Ciao1 G A 2: 127,087,684 (GRCm39) T217I probably damaging Het
Cldn1 A T 16: 26,181,924 (GRCm39) I95N probably damaging Het
Cluh C T 11: 74,558,772 (GRCm39) R1253C possibly damaging Het
Cngb3 A T 4: 19,505,187 (GRCm39) Q640L probably benign Het
Cyp2c40 A T 19: 39,766,443 (GRCm39) V384D probably damaging Het
Cyp2d26 T A 15: 82,674,672 (GRCm39) M437L probably benign Het
Cyp2j7 T C 4: 96,103,591 (GRCm39) T315A probably damaging Het
D430041D05Rik A G 2: 104,087,189 (GRCm39) S596P probably benign Het
Dagla A T 19: 10,233,053 (GRCm39) V448D probably damaging Het
Ddx59 A T 1: 136,344,594 (GRCm39) E88D probably benign Het
Dnhd1 A G 7: 105,300,804 (GRCm39) I54V probably benign Het
Dnttip1 A C 2: 164,593,162 (GRCm39) D95A probably benign Het
Efna3 T C 3: 89,222,818 (GRCm39) T207A probably benign Het
Eprs1 A C 1: 185,139,895 (GRCm39) S995R probably benign Het
Eprs1 G A 1: 185,139,896 (GRCm39) S995N probably benign Het
Erbb2 T C 11: 98,311,746 (GRCm39) V94A possibly damaging Het
Etl4 A T 2: 20,771,345 (GRCm39) I607F possibly damaging Het
Ets2 G T 16: 95,516,121 (GRCm39) E234* probably null Het
Fgf6 A C 6: 126,992,814 (GRCm39) Y89S probably damaging Het
Fmn2 C T 1: 174,436,194 (GRCm39) Q722* probably null Het
Gata3un CGG CG 2: 9,888,075 (GRCm39) probably null Het
Gdpd5 A G 7: 99,103,031 (GRCm39) D330G Het
Glipr1 A G 10: 111,832,801 (GRCm39) S46P probably damaging Het
Gnptab A G 10: 88,268,992 (GRCm39) Y565C probably damaging Het
H2-M10.2 C T 17: 36,596,936 (GRCm39) V47I probably benign Het
Heatr5b T A 17: 79,060,679 (GRCm39) K1999* probably null Het
Iqgap3 C A 3: 88,016,176 (GRCm39) F986L probably damaging Het
Krt87 G T 15: 101,336,484 (GRCm39) C56* probably null Het
Ldlr A G 9: 21,646,626 (GRCm39) D264G probably damaging Het
Lrrk2 A T 15: 91,621,420 (GRCm39) D998V probably benign Het
Mcm5 C T 8: 75,844,168 (GRCm39) S313F probably benign Het
Mmp9 A G 2: 164,793,146 (GRCm39) N432D probably benign Het
Mrc1 A G 2: 14,324,110 (GRCm39) N1149S probably benign Het
Mta1 A T 12: 113,095,085 (GRCm39) M448L probably benign Het
Myo1c T A 11: 75,559,899 (GRCm39) V661E probably benign Het
Ndc1 T C 4: 107,247,863 (GRCm39) probably null Het
Npy A C 6: 49,804,545 (GRCm39) T89P possibly damaging Het
Or12e13 T G 2: 87,663,478 (GRCm39) F32V probably benign Het
Or52e19 A G 7: 102,959,452 (GRCm39) I175V probably benign Het
Or52e8 A T 7: 104,624,856 (GRCm39) M116K probably damaging Het
Or8b12i A G 9: 20,082,093 (GRCm39) V258A probably damaging Het
Osgin2 G T 4: 15,998,427 (GRCm39) H398Q probably damaging Het
Pepd A C 7: 34,743,218 (GRCm39) D419A probably benign Het
Pikfyve A T 1: 65,303,561 (GRCm39) S1694C probably benign Het
Polq A G 16: 36,843,173 (GRCm39) I236V probably benign Het
Prkag3 T G 1: 74,786,378 (GRCm39) Q189P probably damaging Het
Rab6b A T 9: 103,017,601 (GRCm39) T31S probably benign Het
Ralgapb C T 2: 158,268,283 (GRCm39) P129S possibly damaging Het
Ryr3 A T 2: 112,491,966 (GRCm39) L3795Q probably damaging Het
Sash1 C T 10: 8,605,169 (GRCm39) V1074M probably benign Het
Scfd2 T C 5: 74,680,235 (GRCm39) D306G probably damaging Het
Scg2 A G 1: 79,412,936 (GRCm39) Y556H probably damaging Het
Serpina3j A G 12: 104,286,093 (GRCm39) N416S probably damaging Het
Serpinb6c T A 13: 34,081,421 (GRCm39) Q76L probably null Het
Setd7 G A 3: 51,450,139 (GRCm39) Q96* probably null Het
Sf3b4 C T 3: 96,080,946 (GRCm39) R85W probably damaging Het
Sik3 T A 9: 46,120,117 (GRCm39) H735Q probably benign Het
Slain1 A C 14: 103,902,112 (GRCm39) T60P Het
Slc36a3 T C 11: 55,040,726 (GRCm39) E69G unknown Het
Sorcs3 A T 19: 48,711,364 (GRCm39) Y643F probably damaging Het
Spta1 A G 1: 174,035,880 (GRCm39) Y1062C probably damaging Het
Ssc5d C T 7: 4,940,599 (GRCm39) P904L probably benign Het
Stat5b T A 11: 100,699,276 (GRCm39) H25L possibly damaging Het
Synj2 A G 17: 6,063,794 (GRCm39) I513V probably benign Het
Tenm2 T C 11: 36,834,791 (GRCm39) E68G probably damaging Het
Thsd7a C T 6: 12,352,022 (GRCm39) G1058R Het
Traf3ip2 T A 10: 39,521,772 (GRCm39) D443E probably benign Het
Traf6 G T 2: 101,524,625 (GRCm39) C235F probably damaging Het
Treh A G 9: 44,592,416 (GRCm39) D47G probably damaging Het
Txndc16 A T 14: 45,442,799 (GRCm39) F132Y probably damaging Het
Uggt1 A T 1: 36,273,886 (GRCm39) probably null Het
Usp25 A T 16: 76,874,046 (GRCm39) I541F probably damaging Het
Zfp51 A G 17: 21,684,291 (GRCm39) E302G probably damaging Het
Zfp648 A T 1: 154,080,110 (GRCm39) T90S probably benign Het
Zfp84 A G 7: 29,476,264 (GRCm39) T319A possibly damaging Het
Zkscan17 T A 11: 59,378,037 (GRCm39) H538L probably damaging Het
Zyg11a G T 4: 108,062,376 (GRCm39) P142T probably damaging Het
Other mutations in Kif9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Kif9 APN 9 110,314,138 (GRCm39) missense probably benign 0.03
IGL02273:Kif9 APN 9 110,339,538 (GRCm39) missense probably damaging 0.99
IGL02818:Kif9 APN 9 110,314,217 (GRCm39) missense probably damaging 1.00
R0034:Kif9 UTSW 9 110,348,679 (GRCm39) missense probably benign 0.23
R0034:Kif9 UTSW 9 110,348,679 (GRCm39) missense probably benign 0.23
R0047:Kif9 UTSW 9 110,314,106 (GRCm39) missense probably benign 0.05
R0047:Kif9 UTSW 9 110,314,106 (GRCm39) missense probably benign 0.05
R0137:Kif9 UTSW 9 110,314,106 (GRCm39) missense probably damaging 1.00
R0594:Kif9 UTSW 9 110,340,408 (GRCm39) missense probably benign 0.22
R1503:Kif9 UTSW 9 110,339,506 (GRCm39) missense possibly damaging 0.89
R1657:Kif9 UTSW 9 110,319,034 (GRCm39) missense possibly damaging 0.82
R1826:Kif9 UTSW 9 110,346,701 (GRCm39) missense probably benign 0.34
R1856:Kif9 UTSW 9 110,346,787 (GRCm39) missense probably null 1.00
R2076:Kif9 UTSW 9 110,314,100 (GRCm39) splice site probably null
R3407:Kif9 UTSW 9 110,348,208 (GRCm39) missense probably damaging 1.00
R4247:Kif9 UTSW 9 110,325,027 (GRCm39) critical splice donor site probably null
R4487:Kif9 UTSW 9 110,323,552 (GRCm39) missense probably null 1.00
R4515:Kif9 UTSW 9 110,318,935 (GRCm39) missense probably benign 0.38
R4880:Kif9 UTSW 9 110,330,703 (GRCm39) missense probably damaging 0.98
R5024:Kif9 UTSW 9 110,312,161 (GRCm39) missense possibly damaging 0.81
R5093:Kif9 UTSW 9 110,318,965 (GRCm39) missense probably damaging 1.00
R5181:Kif9 UTSW 9 110,350,336 (GRCm39) missense probably damaging 1.00
R5362:Kif9 UTSW 9 110,319,012 (GRCm39) missense probably damaging 0.99
R5379:Kif9 UTSW 9 110,350,371 (GRCm39) missense probably benign 0.00
R5628:Kif9 UTSW 9 110,343,621 (GRCm39) nonsense probably null
R5653:Kif9 UTSW 9 110,353,999 (GRCm39) missense probably damaging 1.00
R5698:Kif9 UTSW 9 110,339,532 (GRCm39) missense probably benign
R5758:Kif9 UTSW 9 110,318,947 (GRCm39) missense probably damaging 1.00
R5986:Kif9 UTSW 9 110,319,094 (GRCm39) missense probably benign 0.05
R6103:Kif9 UTSW 9 110,318,917 (GRCm39) missense possibly damaging 0.82
R6247:Kif9 UTSW 9 110,317,612 (GRCm39) missense possibly damaging 0.78
R6255:Kif9 UTSW 9 110,346,902 (GRCm39) splice site probably null
R6991:Kif9 UTSW 9 110,323,690 (GRCm39) missense probably damaging 1.00
R7113:Kif9 UTSW 9 110,335,732 (GRCm39) missense probably damaging 1.00
R7459:Kif9 UTSW 9 110,348,109 (GRCm39) missense probably damaging 1.00
R7593:Kif9 UTSW 9 110,350,421 (GRCm39) missense possibly damaging 0.54
R7892:Kif9 UTSW 9 110,343,682 (GRCm39) missense not run
R8050:Kif9 UTSW 9 110,348,208 (GRCm39) missense probably damaging 1.00
R8370:Kif9 UTSW 9 110,317,681 (GRCm39) missense probably damaging 1.00
R8549:Kif9 UTSW 9 110,343,487 (GRCm39) splice site probably null
R8751:Kif9 UTSW 9 110,330,724 (GRCm39) missense probably benign 0.03
R8830:Kif9 UTSW 9 110,353,998 (GRCm39) missense probably damaging 1.00
R9519:Kif9 UTSW 9 110,350,344 (GRCm39) missense probably damaging 0.98
R9605:Kif9 UTSW 9 110,346,710 (GRCm39) missense probably benign 0.01
R9776:Kif9 UTSW 9 110,350,398 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAAGGCAGCTGTCCATTTC -3'
(R):5'- AGCCTAGTGAAATGACATAGGTC -3'

Sequencing Primer
(F):5'- AAGGCAGCTGTCCATTTCTTTTC -3'
(R):5'- CCTAGTGAAATGACATAGGTCTGTAC -3'
Posted On 2022-07-18