Incidental Mutation 'R9489:Kif9'
ID 716837
Institutional Source Beutler Lab
Gene Symbol Kif9
Ensembl Gene ENSMUSG00000032489
Gene Name kinesin family member 9
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock # R9489 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 110476958-110525179 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 110517642 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 616 (R616H)
Ref Sequence ENSEMBL: ENSMUSP00000057896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061155] [ENSMUST00000084952] [ENSMUST00000197248] [ENSMUST00000198043]
AlphaFold Q9WV04
Predicted Effect probably benign
Transcript: ENSMUST00000061155
AA Change: R616H

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000057896
Gene: ENSMUSG00000032489
AA Change: R616H

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084952
AA Change: R616H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000082016
Gene: ENSMUSG00000032489
AA Change: R616H

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197248
AA Change: R616H

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000142734
Gene: ENSMUSG00000032489
AA Change: R616H

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 6e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198043
SMART Domains Protein: ENSMUSP00000142689
Gene: ENSMUSG00000032489

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 476 5e-14 BLAST
low complexity region 489 501 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik T A 13: 60,854,869 S24C probably damaging Het
6430548M08Rik G A 8: 120,145,641 V103I possibly damaging Het
9230102O04Rik CGG CG 2: 9,883,264 probably null Het
Acaca C T 11: 84,293,016 T1240I probably benign Het
Adam19 T C 11: 46,137,622 V694A probably benign Het
Adipor1 A G 1: 134,424,815 D108G probably damaging Het
Arhgef4 A G 1: 34,722,664 T334A unknown Het
Bcl11a T C 11: 24,164,582 F642L probably benign Het
Camk2d T C 3: 126,767,560 Y108H probably damaging Het
Catsper1 A G 19: 5,337,757 T355A probably benign Het
Ccdc69 T A 11: 55,055,030 N50I possibly damaging Het
Chd8 A T 14: 52,219,598 L971Q probably damaging Het
Chrna10 C A 7: 102,113,594 A130S probably benign Het
Ciao1 G A 2: 127,245,764 T217I probably damaging Het
Cldn1 A T 16: 26,363,174 I95N probably damaging Het
Cluh C T 11: 74,667,946 R1253C possibly damaging Het
Cngb3 A T 4: 19,505,187 Q640L probably benign Het
Cyp2c40 A T 19: 39,777,999 V384D probably damaging Het
Cyp2d26 T A 15: 82,790,471 M437L probably benign Het
Cyp2j7 T C 4: 96,215,354 T315A probably damaging Het
D430041D05Rik A G 2: 104,256,844 S596P probably benign Het
Dagla A T 19: 10,255,689 V448D probably damaging Het
Ddx59 A T 1: 136,416,856 E88D probably benign Het
Dnhd1 A G 7: 105,651,597 I54V probably benign Het
Dnttip1 A C 2: 164,751,242 D95A probably benign Het
Efna3 T C 3: 89,315,511 T207A probably benign Het
Eprs A C 1: 185,407,698 S995R probably benign Het
Eprs G A 1: 185,407,699 S995N probably benign Het
Erbb2 T C 11: 98,420,920 V94A possibly damaging Het
Etl4 A T 2: 20,766,534 I607F possibly damaging Het
Ets2 G T 16: 95,715,077 E234* probably null Het
Fgf6 A C 6: 127,015,851 Y89S probably damaging Het
Fmn2 C T 1: 174,608,628 Q722* probably null Het
Gatsl2 G T 5: 134,135,697 V166L probably benign Het
Gdpd5 A G 7: 99,453,824 D330G Het
Glipr1 A G 10: 111,996,896 S46P probably damaging Het
Gnptab A G 10: 88,433,130 Y565C probably damaging Het
H2-M10.2 C T 17: 36,286,044 V47I probably benign Het
Heatr5b T A 17: 78,753,250 K1999* probably null Het
Iqgap3 C A 3: 88,108,869 F986L probably damaging Het
Krt87 G T 15: 101,438,603 C56* probably null Het
Ldlr A G 9: 21,735,330 D264G probably damaging Het
Lrrk2 A T 15: 91,737,217 D998V probably benign Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Mmp9 A G 2: 164,951,226 N432D probably benign Het
Mrc1 A G 2: 14,319,299 N1149S probably benign Het
Mta1 A T 12: 113,131,465 M448L probably benign Het
Myo1c T A 11: 75,669,073 V661E probably benign Het
Ndc1 T C 4: 107,390,666 probably null Het
Npy A C 6: 49,827,565 T89P possibly damaging Het
Olfr1148 T G 2: 87,833,134 F32V probably benign Het
Olfr596 A G 7: 103,310,245 I175V probably benign Het
Olfr671 A T 7: 104,975,649 M116K probably damaging Het
Olfr870 A G 9: 20,170,797 V258A probably damaging Het
Osgin2 G T 4: 15,998,427 H398Q probably damaging Het
Pepd A C 7: 35,043,793 D419A probably benign Het
Pikfyve A T 1: 65,264,402 S1694C probably benign Het
Polq A G 16: 37,022,811 I236V probably benign Het
Prkag3 T G 1: 74,747,219 Q189P probably damaging Het
Rab6b A T 9: 103,140,402 T31S probably benign Het
Ralgapb C T 2: 158,426,363 P129S possibly damaging Het
Ryr3 A T 2: 112,661,621 L3795Q probably damaging Het
Sash1 C T 10: 8,729,405 V1074M probably benign Het
Scfd2 T C 5: 74,519,574 D306G probably damaging Het
Scg2 A G 1: 79,435,219 Y556H probably damaging Het
Serpina3j A G 12: 104,319,834 N416S probably damaging Het
Serpinb6c T A 13: 33,897,438 Q76L probably null Het
Setd7 G A 3: 51,542,718 Q96* probably null Het
Sf3b4 C T 3: 96,173,630 R85W probably damaging Het
Sik3 T A 9: 46,208,819 H735Q probably benign Het
Slain1 A C 14: 103,664,676 T60P Het
Slc36a3 T C 11: 55,149,900 E69G unknown Het
Sorcs3 A T 19: 48,722,925 Y643F probably damaging Het
Spta1 A G 1: 174,208,314 Y1062C probably damaging Het
Ssc5d C T 7: 4,937,600 P904L probably benign Het
Stat5b T A 11: 100,808,450 H25L possibly damaging Het
Synj2 A G 17: 6,013,519 I513V probably benign Het
Tenm2 T C 11: 36,943,964 E68G probably damaging Het
Thsd7a C T 6: 12,352,023 G1058R Het
Traf3ip2 T A 10: 39,645,776 D443E probably benign Het
Traf6 G T 2: 101,694,280 C235F probably damaging Het
Treh A G 9: 44,681,119 D47G probably damaging Het
Txndc16 A T 14: 45,205,342 F132Y probably damaging Het
Uggt1 A T 1: 36,234,805 probably null Het
Usp25 A T 16: 77,077,158 I541F probably damaging Het
Zfp51 A G 17: 21,464,029 E302G probably damaging Het
Zfp648 A T 1: 154,204,364 T90S probably benign Het
Zfp84 A G 7: 29,776,839 T319A possibly damaging Het
Zkscan17 T A 11: 59,487,211 H538L probably damaging Het
Zyg11a G T 4: 108,205,179 P142T probably damaging Het
Other mutations in Kif9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Kif9 APN 9 110485070 missense probably benign 0.03
IGL02273:Kif9 APN 9 110510470 missense probably damaging 0.99
IGL02818:Kif9 APN 9 110485149 missense probably damaging 1.00
R0034:Kif9 UTSW 9 110519611 missense probably benign 0.23
R0034:Kif9 UTSW 9 110519611 missense probably benign 0.23
R0047:Kif9 UTSW 9 110485038 missense probably benign 0.05
R0047:Kif9 UTSW 9 110485038 missense probably benign 0.05
R0137:Kif9 UTSW 9 110485038 missense probably damaging 1.00
R0594:Kif9 UTSW 9 110511340 missense probably benign 0.22
R1503:Kif9 UTSW 9 110510438 missense possibly damaging 0.89
R1657:Kif9 UTSW 9 110489966 missense possibly damaging 0.82
R1826:Kif9 UTSW 9 110517633 missense probably benign 0.34
R1856:Kif9 UTSW 9 110517719 missense probably null 1.00
R2076:Kif9 UTSW 9 110485032 splice site probably null
R3407:Kif9 UTSW 9 110519140 missense probably damaging 1.00
R4247:Kif9 UTSW 9 110495959 critical splice donor site probably null
R4487:Kif9 UTSW 9 110494484 missense probably null 1.00
R4515:Kif9 UTSW 9 110489867 missense probably benign 0.38
R4880:Kif9 UTSW 9 110501635 missense probably damaging 0.98
R5024:Kif9 UTSW 9 110483093 missense possibly damaging 0.81
R5093:Kif9 UTSW 9 110489897 missense probably damaging 1.00
R5181:Kif9 UTSW 9 110521268 missense probably damaging 1.00
R5362:Kif9 UTSW 9 110489944 missense probably damaging 0.99
R5379:Kif9 UTSW 9 110521303 missense probably benign 0.00
R5628:Kif9 UTSW 9 110514553 nonsense probably null
R5653:Kif9 UTSW 9 110524931 missense probably damaging 1.00
R5698:Kif9 UTSW 9 110510464 missense probably benign
R5758:Kif9 UTSW 9 110489879 missense probably damaging 1.00
R5986:Kif9 UTSW 9 110490026 missense probably benign 0.05
R6103:Kif9 UTSW 9 110489849 missense possibly damaging 0.82
R6247:Kif9 UTSW 9 110488544 missense possibly damaging 0.78
R6255:Kif9 UTSW 9 110517834 splice site probably null
R6991:Kif9 UTSW 9 110494622 missense probably damaging 1.00
R7113:Kif9 UTSW 9 110506664 missense probably damaging 1.00
R7459:Kif9 UTSW 9 110519041 missense probably damaging 1.00
R7593:Kif9 UTSW 9 110521353 missense possibly damaging 0.54
R7892:Kif9 UTSW 9 110514614 missense not run
R8050:Kif9 UTSW 9 110519140 missense probably damaging 1.00
R8370:Kif9 UTSW 9 110488613 missense probably damaging 1.00
R8549:Kif9 UTSW 9 110514419 splice site probably null
R8751:Kif9 UTSW 9 110501656 missense probably benign 0.03
R8830:Kif9 UTSW 9 110524930 missense probably damaging 1.00
R9519:Kif9 UTSW 9 110521276 missense probably damaging 0.98
R9605:Kif9 UTSW 9 110517642 missense probably benign 0.01
R9776:Kif9 UTSW 9 110521330 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAAGGCAGCTGTCCATTTC -3'
(R):5'- AGCCTAGTGAAATGACATAGGTC -3'

Sequencing Primer
(F):5'- AAGGCAGCTGTCCATTTCTTTTC -3'
(R):5'- CCTAGTGAAATGACATAGGTCTGTAC -3'
Posted On 2022-07-18