Incidental Mutation 'R9489:Lrrk2'
ID 716861
Institutional Source Beutler Lab
Gene Symbol Lrrk2
Ensembl Gene ENSMUSG00000036273
Gene Name leucine-rich repeat kinase 2
Synonyms 9330188B09Rik, 4921513O20Rik, LOC381026, cI-46, D630001M17Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.520) question?
Stock # R9489 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 91673175-91816120 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 91737217 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 998 (D998V)
Ref Sequence ENSEMBL: ENSMUSP00000052584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060642]
AlphaFold Q5S006
Predicted Effect probably benign
Transcript: ENSMUST00000060642
AA Change: D998V

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000052584
Gene: ENSMUSG00000036273
AA Change: D998V

DomainStartEndE-ValueType
low complexity region 138 156 N/A INTRINSIC
low complexity region 332 347 N/A INTRINSIC
ANK 708 737 3.95e1 SMART
ANK 770 800 4.58e2 SMART
low complexity region 890 901 N/A INTRINSIC
low complexity region 953 966 N/A INTRINSIC
low complexity region 971 979 N/A INTRINSIC
LRR 1010 1033 9.96e-1 SMART
LRR 1034 1057 8.01e0 SMART
LRR 1082 1105 2.45e0 SMART
LRR 1128 1151 9.3e-1 SMART
LRR 1195 1219 3.24e0 SMART
LRR 1244 1266 3.87e1 SMART
LRR 1267 1291 4.98e1 SMART
Pfam:Roc 1336 1456 4.9e-32 PFAM
Pfam:Ras 1336 1489 3.3e-17 PFAM
Pfam:COR 1524 1740 4e-28 PFAM
Pfam:Pkinase 1881 2132 4.7e-40 PFAM
Pfam:Pkinase_Tyr 1882 2132 6.8e-39 PFAM
WD40 2231 2276 3.09e-1 SMART
WD40 2401 2438 1.37e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired response to dopamine, amphetamine, and quinpirole. Mice homozygous for one knock-out allele exhibit increased neurite growth. Mice homozygous for different knock-out alleles exhibit alopecia due to excessive grooming or kdiney atrophy. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(6) Targeted, other(1)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik T A 13: 60,854,869 (GRCm38) S24C probably damaging Het
6430548M08Rik G A 8: 120,145,641 (GRCm38) V103I possibly damaging Het
Acaca C T 11: 84,293,016 (GRCm38) T1240I probably benign Het
Adam19 T C 11: 46,137,622 (GRCm38) V694A probably benign Het
Adipor1 A G 1: 134,424,815 (GRCm38) D108G probably damaging Het
Arhgef4 A G 1: 34,722,664 (GRCm38) T334A unknown Het
Bcl11a T C 11: 24,164,582 (GRCm38) F642L probably benign Het
Camk2d T C 3: 126,767,560 (GRCm38) Y108H probably damaging Het
Castor2 G T 5: 134,135,697 (GRCm38) V166L probably benign Het
Catsper1 A G 19: 5,337,757 (GRCm38) T355A probably benign Het
Ccdc69 T A 11: 55,055,030 (GRCm38) N50I possibly damaging Het
Chd8 A T 14: 52,219,598 (GRCm38) L971Q probably damaging Het
Chrna10 C A 7: 102,113,594 (GRCm38) A130S probably benign Het
Ciao1 G A 2: 127,245,764 (GRCm38) T217I probably damaging Het
Cldn1 A T 16: 26,363,174 (GRCm38) I95N probably damaging Het
Cluh C T 11: 74,667,946 (GRCm38) R1253C possibly damaging Het
Cngb3 A T 4: 19,505,187 (GRCm38) Q640L probably benign Het
Cyp2c40 A T 19: 39,777,999 (GRCm38) V384D probably damaging Het
Cyp2d26 T A 15: 82,790,471 (GRCm38) M437L probably benign Het
Cyp2j7 T C 4: 96,215,354 (GRCm38) T315A probably damaging Het
D430041D05Rik A G 2: 104,256,844 (GRCm38) S596P probably benign Het
Dagla A T 19: 10,255,689 (GRCm38) V448D probably damaging Het
Ddx59 A T 1: 136,416,856 (GRCm38) E88D probably benign Het
Dnhd1 A G 7: 105,651,597 (GRCm38) I54V probably benign Het
Dnttip1 A C 2: 164,751,242 (GRCm38) D95A probably benign Het
Efna3 T C 3: 89,315,511 (GRCm38) T207A probably benign Het
Eprs1 A C 1: 185,407,698 (GRCm38) S995R probably benign Het
Eprs1 G A 1: 185,407,699 (GRCm38) S995N probably benign Het
Erbb2 T C 11: 98,420,920 (GRCm38) V94A possibly damaging Het
Etl4 A T 2: 20,766,534 (GRCm38) I607F possibly damaging Het
Ets2 G T 16: 95,715,077 (GRCm38) E234* probably null Het
Fgf6 A C 6: 127,015,851 (GRCm38) Y89S probably damaging Het
Fmn2 C T 1: 174,608,628 (GRCm38) Q722* probably null Het
Gata3un CGG CG 2: 9,883,264 (GRCm38) probably null Het
Gdpd5 A G 7: 99,453,824 (GRCm38) D330G Het
Glipr1 A G 10: 111,996,896 (GRCm38) S46P probably damaging Het
Gnptab A G 10: 88,433,130 (GRCm38) Y565C probably damaging Het
H2-M10.2 C T 17: 36,286,044 (GRCm38) V47I probably benign Het
Heatr5b T A 17: 78,753,250 (GRCm38) K1999* probably null Het
Iqgap3 C A 3: 88,108,869 (GRCm38) F986L probably damaging Het
Kif9 G A 9: 110,517,642 (GRCm38) R616H probably benign Het
Krt87 G T 15: 101,438,603 (GRCm38) C56* probably null Het
Ldlr A G 9: 21,735,330 (GRCm38) D264G probably damaging Het
Mcm5 C T 8: 75,117,540 (GRCm38) S313F probably benign Het
Mmp9 A G 2: 164,951,226 (GRCm38) N432D probably benign Het
Mrc1 A G 2: 14,319,299 (GRCm38) N1149S probably benign Het
Mta1 A T 12: 113,131,465 (GRCm38) M448L probably benign Het
Myo1c T A 11: 75,669,073 (GRCm38) V661E probably benign Het
Ndc1 T C 4: 107,390,666 (GRCm38) probably null Het
Npy A C 6: 49,827,565 (GRCm38) T89P possibly damaging Het
Or12e13 T G 2: 87,833,134 (GRCm38) F32V probably benign Het
Or52e19 A G 7: 103,310,245 (GRCm38) I175V probably benign Het
Or52e8 A T 7: 104,975,649 (GRCm38) M116K probably damaging Het
Or8b12i A G 9: 20,170,797 (GRCm38) V258A probably damaging Het
Osgin2 G T 4: 15,998,427 (GRCm38) H398Q probably damaging Het
Pepd A C 7: 35,043,793 (GRCm38) D419A probably benign Het
Pikfyve A T 1: 65,264,402 (GRCm38) S1694C probably benign Het
Polq A G 16: 37,022,811 (GRCm38) I236V probably benign Het
Prkag3 T G 1: 74,747,219 (GRCm38) Q189P probably damaging Het
Rab6b A T 9: 103,140,402 (GRCm38) T31S probably benign Het
Ralgapb C T 2: 158,426,363 (GRCm38) P129S possibly damaging Het
Ryr3 A T 2: 112,661,621 (GRCm38) L3795Q probably damaging Het
Sash1 C T 10: 8,729,405 (GRCm38) V1074M probably benign Het
Scfd2 T C 5: 74,519,574 (GRCm38) D306G probably damaging Het
Scg2 A G 1: 79,435,219 (GRCm38) Y556H probably damaging Het
Serpina3j A G 12: 104,319,834 (GRCm38) N416S probably damaging Het
Serpinb6c T A 13: 33,897,438 (GRCm38) Q76L probably null Het
Setd7 G A 3: 51,542,718 (GRCm38) Q96* probably null Het
Sf3b4 C T 3: 96,173,630 (GRCm38) R85W probably damaging Het
Sik3 T A 9: 46,208,819 (GRCm38) H735Q probably benign Het
Slain1 A C 14: 103,664,676 (GRCm38) T60P Het
Slc36a3 T C 11: 55,149,900 (GRCm38) E69G unknown Het
Sorcs3 A T 19: 48,722,925 (GRCm38) Y643F probably damaging Het
Spta1 A G 1: 174,208,314 (GRCm38) Y1062C probably damaging Het
Ssc5d C T 7: 4,937,600 (GRCm38) P904L probably benign Het
Stat5b T A 11: 100,808,450 (GRCm38) H25L possibly damaging Het
Synj2 A G 17: 6,013,519 (GRCm38) I513V probably benign Het
Tenm2 T C 11: 36,943,964 (GRCm38) E68G probably damaging Het
Thsd7a C T 6: 12,352,023 (GRCm38) G1058R Het
Traf3ip2 T A 10: 39,645,776 (GRCm38) D443E probably benign Het
Traf6 G T 2: 101,694,280 (GRCm38) C235F probably damaging Het
Treh A G 9: 44,681,119 (GRCm38) D47G probably damaging Het
Txndc16 A T 14: 45,205,342 (GRCm38) F132Y probably damaging Het
Uggt1 A T 1: 36,234,805 (GRCm38) probably null Het
Usp25 A T 16: 77,077,158 (GRCm38) I541F probably damaging Het
Zfp51 A G 17: 21,464,029 (GRCm38) E302G probably damaging Het
Zfp648 A T 1: 154,204,364 (GRCm38) T90S probably benign Het
Zfp84 A G 7: 29,776,839 (GRCm38) T319A possibly damaging Het
Zkscan17 T A 11: 59,487,211 (GRCm38) H538L probably damaging Het
Zyg11a G T 4: 108,205,179 (GRCm38) P142T probably damaging Het
Other mutations in Lrrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Lrrk2 APN 15 91,747,799 (GRCm38) missense possibly damaging 0.90
IGL00542:Lrrk2 APN 15 91,699,943 (GRCm38) missense probably benign
IGL00770:Lrrk2 APN 15 91,801,833 (GRCm38) splice site probably benign
IGL00774:Lrrk2 APN 15 91,801,833 (GRCm38) splice site probably benign
IGL00791:Lrrk2 APN 15 91,779,841 (GRCm38) missense probably damaging 1.00
IGL00827:Lrrk2 APN 15 91,755,790 (GRCm38) missense probably damaging 1.00
IGL00843:Lrrk2 APN 15 91,757,058 (GRCm38) missense possibly damaging 0.58
IGL01109:Lrrk2 APN 15 91,738,832 (GRCm38) missense probably damaging 1.00
IGL01293:Lrrk2 APN 15 91,726,137 (GRCm38) missense probably benign 0.21
IGL01296:Lrrk2 APN 15 91,683,142 (GRCm38) missense probably benign
IGL01301:Lrrk2 APN 15 91,767,339 (GRCm38) missense probably damaging 1.00
IGL01360:Lrrk2 APN 15 91,700,569 (GRCm38) splice site probably null
IGL01465:Lrrk2 APN 15 91,728,925 (GRCm38) missense probably benign 0.21
IGL01529:Lrrk2 APN 15 91,812,313 (GRCm38) missense possibly damaging 0.92
IGL01557:Lrrk2 APN 15 91,699,989 (GRCm38) missense probably damaging 1.00
IGL01560:Lrrk2 APN 15 91,774,988 (GRCm38) missense probably benign 0.33
IGL01991:Lrrk2 APN 15 91,779,946 (GRCm38) missense probably damaging 0.99
IGL02003:Lrrk2 APN 15 91,731,491 (GRCm38) missense probably damaging 0.99
IGL02325:Lrrk2 APN 15 91,726,308 (GRCm38) critical splice donor site probably null
IGL02711:Lrrk2 APN 15 91,685,822 (GRCm38) missense possibly damaging 0.71
IGL02869:Lrrk2 APN 15 91,750,277 (GRCm38) missense probably damaging 1.00
IGL03104:Lrrk2 APN 15 91,747,755 (GRCm38) missense possibly damaging 0.68
IGL03179:Lrrk2 APN 15 91,700,578 (GRCm38) missense probably damaging 1.00
IGL03395:Lrrk2 APN 15 91,797,414 (GRCm38) splice site probably null
horned UTSW 15 91,772,858 (GRCm38) missense probably damaging 1.00
R1312_Lrrk2_980 UTSW 15 91,699,895 (GRCm38) missense probably damaging 1.00
R4710_lrrk2_232 UTSW 15 91,699,927 (GRCm38) missense possibly damaging 0.88
R5245_Lrrk2_127 UTSW 15 91,796,089 (GRCm38) missense probably damaging 1.00
spree UTSW 15 91,702,247 (GRCm38) missense probably benign 0.00
Spur UTSW 15 91,774,995 (GRCm38) nonsense probably null
3-1:Lrrk2 UTSW 15 91,801,934 (GRCm38) missense probably benign 0.01
ANU18:Lrrk2 UTSW 15 91,767,339 (GRCm38) missense probably damaging 1.00
H8562:Lrrk2 UTSW 15 91,673,358 (GRCm38) missense probably benign
H8786:Lrrk2 UTSW 15 91,673,358 (GRCm38) missense probably benign
IGL02835:Lrrk2 UTSW 15 91,814,660 (GRCm38) critical splice acceptor site probably null
R0014:Lrrk2 UTSW 15 91,802,045 (GRCm38) splice site probably benign
R0014:Lrrk2 UTSW 15 91,802,045 (GRCm38) splice site probably benign
R0078:Lrrk2 UTSW 15 91,734,009 (GRCm38) missense probably benign 0.01
R0100:Lrrk2 UTSW 15 91,745,796 (GRCm38) missense probably damaging 1.00
R0282:Lrrk2 UTSW 15 91,778,414 (GRCm38) splice site probably benign
R0448:Lrrk2 UTSW 15 91,709,305 (GRCm38) missense probably damaging 0.99
R0449:Lrrk2 UTSW 15 91,750,275 (GRCm38) missense probably damaging 1.00
R0610:Lrrk2 UTSW 15 91,815,416 (GRCm38) missense probably benign
R0617:Lrrk2 UTSW 15 91,752,278 (GRCm38) missense probably benign 0.00
R0632:Lrrk2 UTSW 15 91,796,028 (GRCm38) missense probably damaging 0.98
R0639:Lrrk2 UTSW 15 91,772,996 (GRCm38) missense probably benign 0.03
R0661:Lrrk2 UTSW 15 91,787,016 (GRCm38) missense probably damaging 1.00
R0666:Lrrk2 UTSW 15 91,757,070 (GRCm38) critical splice donor site probably null
R0764:Lrrk2 UTSW 15 91,775,046 (GRCm38) splice site probably null
R0766:Lrrk2 UTSW 15 91,699,895 (GRCm38) missense probably damaging 1.00
R0845:Lrrk2 UTSW 15 91,755,962 (GRCm38) missense probably benign 0.22
R0940:Lrrk2 UTSW 15 91,729,081 (GRCm38) missense possibly damaging 0.83
R0970:Lrrk2 UTSW 15 91,729,169 (GRCm38) missense probably benign 0.22
R1080:Lrrk2 UTSW 15 91,673,689 (GRCm38) missense probably benign 0.01
R1114:Lrrk2 UTSW 15 91,700,468 (GRCm38) nonsense probably null
R1223:Lrrk2 UTSW 15 91,673,635 (GRCm38) missense probably benign 0.00
R1289:Lrrk2 UTSW 15 91,812,360 (GRCm38) missense probably benign 0.00
R1296:Lrrk2 UTSW 15 91,728,920 (GRCm38) missense probably damaging 1.00
R1312:Lrrk2 UTSW 15 91,699,895 (GRCm38) missense probably damaging 1.00
R1637:Lrrk2 UTSW 15 91,734,058 (GRCm38) missense probably benign
R1773:Lrrk2 UTSW 15 91,779,981 (GRCm38) missense possibly damaging 0.96
R1809:Lrrk2 UTSW 15 91,699,892 (GRCm38) missense possibly damaging 0.86
R1839:Lrrk2 UTSW 15 91,683,134 (GRCm38) missense probably benign 0.00
R1946:Lrrk2 UTSW 15 91,736,661 (GRCm38) splice site probably null
R2160:Lrrk2 UTSW 15 91,796,060 (GRCm38) missense probably damaging 1.00
R2232:Lrrk2 UTSW 15 91,764,716 (GRCm38) missense probably benign 0.05
R2419:Lrrk2 UTSW 15 91,797,526 (GRCm38) splice site probably benign
R2516:Lrrk2 UTSW 15 91,755,927 (GRCm38) missense probably benign
R3110:Lrrk2 UTSW 15 91,814,695 (GRCm38) missense probably benign 0.02
R3112:Lrrk2 UTSW 15 91,814,695 (GRCm38) missense probably benign 0.02
R3801:Lrrk2 UTSW 15 91,737,111 (GRCm38) missense probably benign
R3842:Lrrk2 UTSW 15 91,755,916 (GRCm38) missense probably benign 0.01
R3903:Lrrk2 UTSW 15 91,747,701 (GRCm38) missense probably damaging 1.00
R3903:Lrrk2 UTSW 15 91,747,700 (GRCm38) missense probably damaging 1.00
R3930:Lrrk2 UTSW 15 91,767,461 (GRCm38) critical splice donor site probably null
R3937:Lrrk2 UTSW 15 91,778,504 (GRCm38) missense probably damaging 0.98
R3938:Lrrk2 UTSW 15 91,778,504 (GRCm38) missense probably damaging 0.98
R3938:Lrrk2 UTSW 15 91,712,780 (GRCm38) missense possibly damaging 0.69
R3982:Lrrk2 UTSW 15 91,709,284 (GRCm38) missense probably benign 0.22
R4125:Lrrk2 UTSW 15 91,815,483 (GRCm38) missense probably benign 0.01
R4130:Lrrk2 UTSW 15 91,755,794 (GRCm38) missense probably benign 0.19
R4296:Lrrk2 UTSW 15 91,699,895 (GRCm38) missense probably damaging 1.00
R4465:Lrrk2 UTSW 15 91,747,820 (GRCm38) missense probably damaging 0.96
R4478:Lrrk2 UTSW 15 91,723,188 (GRCm38) missense probably damaging 1.00
R4517:Lrrk2 UTSW 15 91,705,120 (GRCm38) missense probably benign
R4539:Lrrk2 UTSW 15 91,729,142 (GRCm38) missense possibly damaging 0.86
R4654:Lrrk2 UTSW 15 91,765,681 (GRCm38) missense probably damaging 0.96
R4710:Lrrk2 UTSW 15 91,699,927 (GRCm38) missense possibly damaging 0.88
R4722:Lrrk2 UTSW 15 91,688,901 (GRCm38) missense probably damaging 1.00
R4723:Lrrk2 UTSW 15 91,764,759 (GRCm38) missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91,765,747 (GRCm38) missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91,688,849 (GRCm38) missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91,765,747 (GRCm38) missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91,688,849 (GRCm38) missense probably damaging 1.00
R4787:Lrrk2 UTSW 15 91,712,828 (GRCm38) missense probably benign
R4945:Lrrk2 UTSW 15 91,804,920 (GRCm38) missense probably benign 0.02
R4948:Lrrk2 UTSW 15 91,803,389 (GRCm38) missense probably benign 0.20
R5000:Lrrk2 UTSW 15 91,749,878 (GRCm38) missense probably damaging 1.00
R5031:Lrrk2 UTSW 15 91,700,619 (GRCm38) missense possibly damaging 0.50
R5067:Lrrk2 UTSW 15 91,765,790 (GRCm38) missense probably benign 0.01
R5245:Lrrk2 UTSW 15 91,796,089 (GRCm38) missense probably damaging 1.00
R5341:Lrrk2 UTSW 15 91,772,858 (GRCm38) missense probably damaging 1.00
R5460:Lrrk2 UTSW 15 91,814,644 (GRCm38) splice site probably null
R5551:Lrrk2 UTSW 15 91,812,350 (GRCm38) missense probably benign
R5574:Lrrk2 UTSW 15 91,787,016 (GRCm38) missense probably damaging 1.00
R5577:Lrrk2 UTSW 15 91,765,745 (GRCm38) missense probably damaging 1.00
R5685:Lrrk2 UTSW 15 91,803,301 (GRCm38) nonsense probably null
R5712:Lrrk2 UTSW 15 91,702,222 (GRCm38) nonsense probably null
R5728:Lrrk2 UTSW 15 91,774,974 (GRCm38) missense probably benign 0.36
R5782:Lrrk2 UTSW 15 91,702,183 (GRCm38) missense probably damaging 1.00
R5788:Lrrk2 UTSW 15 91,764,648 (GRCm38) missense possibly damaging 0.55
R5821:Lrrk2 UTSW 15 91,709,390 (GRCm38) critical splice donor site probably null
R5852:Lrrk2 UTSW 15 91,755,949 (GRCm38) missense probably damaging 1.00
R5934:Lrrk2 UTSW 15 91,734,046 (GRCm38) missense probably benign 0.00
R5935:Lrrk2 UTSW 15 91,745,831 (GRCm38) missense probably benign 0.14
R5979:Lrrk2 UTSW 15 91,772,945 (GRCm38) missense possibly damaging 0.47
R6101:Lrrk2 UTSW 15 91,723,135 (GRCm38) missense probably benign 0.10
R6114:Lrrk2 UTSW 15 91,747,826 (GRCm38) missense probably benign 0.33
R6259:Lrrk2 UTSW 15 91,702,247 (GRCm38) missense probably benign 0.00
R6376:Lrrk2 UTSW 15 91,742,266 (GRCm38) missense possibly damaging 0.89
R6417:Lrrk2 UTSW 15 91,812,346 (GRCm38) missense probably benign 0.03
R6420:Lrrk2 UTSW 15 91,812,346 (GRCm38) missense probably benign 0.03
R6737:Lrrk2 UTSW 15 91,723,218 (GRCm38) missense possibly damaging 0.50
R7056:Lrrk2 UTSW 15 91,774,995 (GRCm38) nonsense probably null
R7072:Lrrk2 UTSW 15 91,801,920 (GRCm38) missense probably benign 0.03
R7109:Lrrk2 UTSW 15 91,764,782 (GRCm38) missense probably damaging 1.00
R7128:Lrrk2 UTSW 15 91,801,885 (GRCm38) missense probably benign
R7144:Lrrk2 UTSW 15 91,734,055 (GRCm38) missense possibly damaging 0.54
R7187:Lrrk2 UTSW 15 91,757,001 (GRCm38) missense possibly damaging 0.92
R7270:Lrrk2 UTSW 15 91,700,441 (GRCm38) missense probably benign 0.01
R7356:Lrrk2 UTSW 15 91,738,744 (GRCm38) missense probably benign 0.07
R7360:Lrrk2 UTSW 15 91,731,655 (GRCm38) critical splice donor site probably null
R7373:Lrrk2 UTSW 15 91,700,004 (GRCm38) critical splice donor site probably null
R7465:Lrrk2 UTSW 15 91,767,340 (GRCm38) missense probably damaging 1.00
R7477:Lrrk2 UTSW 15 91,812,325 (GRCm38) missense probably damaging 0.98
R7614:Lrrk2 UTSW 15 91,772,858 (GRCm38) missense probably damaging 1.00
R7622:Lrrk2 UTSW 15 91,812,323 (GRCm38) missense probably damaging 1.00
R7658:Lrrk2 UTSW 15 91,700,358 (GRCm38) missense possibly damaging 0.91
R7679:Lrrk2 UTSW 15 91,726,186 (GRCm38) missense possibly damaging 0.58
R7737:Lrrk2 UTSW 15 91,815,446 (GRCm38) missense probably damaging 0.98
R7739:Lrrk2 UTSW 15 91,700,613 (GRCm38) missense probably damaging 1.00
R7740:Lrrk2 UTSW 15 91,767,324 (GRCm38) missense probably damaging 1.00
R7908:Lrrk2 UTSW 15 91,726,152 (GRCm38) missense probably damaging 1.00
R8299:Lrrk2 UTSW 15 91,673,240 (GRCm38) start gained probably benign
R8389:Lrrk2 UTSW 15 91,699,991 (GRCm38) missense probably damaging 1.00
R8462:Lrrk2 UTSW 15 91,731,477 (GRCm38) missense probably benign
R8698:Lrrk2 UTSW 15 91,752,197 (GRCm38) missense probably benign 0.38
R8947:Lrrk2 UTSW 15 91,702,270 (GRCm38) nonsense probably null
R9084:Lrrk2 UTSW 15 91,750,266 (GRCm38) missense
R9086:Lrrk2 UTSW 15 91,755,848 (GRCm38) missense probably benign 0.01
R9096:Lrrk2 UTSW 15 91,673,256 (GRCm38) start gained probably benign
R9097:Lrrk2 UTSW 15 91,673,256 (GRCm38) start gained probably benign
R9267:Lrrk2 UTSW 15 91,700,426 (GRCm38) missense probably damaging 0.99
R9285:Lrrk2 UTSW 15 91,778,483 (GRCm38) missense probably damaging 1.00
R9341:Lrrk2 UTSW 15 91,700,415 (GRCm38) missense probably benign 0.18
R9343:Lrrk2 UTSW 15 91,700,415 (GRCm38) missense probably benign 0.18
R9371:Lrrk2 UTSW 15 91,723,204 (GRCm38) missense probably damaging 1.00
R9424:Lrrk2 UTSW 15 91,752,185 (GRCm38) nonsense probably null
R9502:Lrrk2 UTSW 15 91,723,162 (GRCm38) missense probably damaging 0.98
R9563:Lrrk2 UTSW 15 91,749,840 (GRCm38) missense possibly damaging 0.90
R9576:Lrrk2 UTSW 15 91,752,185 (GRCm38) nonsense probably null
R9605:Lrrk2 UTSW 15 91,737,217 (GRCm38) missense probably benign 0.37
R9635:Lrrk2 UTSW 15 91,812,324 (GRCm38) missense probably benign 0.21
R9641:Lrrk2 UTSW 15 91,787,048 (GRCm38) missense possibly damaging 0.94
R9660:Lrrk2 UTSW 15 91,734,025 (GRCm38) missense probably benign 0.00
R9673:Lrrk2 UTSW 15 91,765,681 (GRCm38) missense probably damaging 1.00
R9708:Lrrk2 UTSW 15 91,750,279 (GRCm38) nonsense probably null
R9728:Lrrk2 UTSW 15 91,734,025 (GRCm38) missense probably benign 0.00
R9757:Lrrk2 UTSW 15 91,811,026 (GRCm38) missense probably benign 0.03
RF001:Lrrk2 UTSW 15 91,736,633 (GRCm38) missense probably benign 0.11
X0028:Lrrk2 UTSW 15 91,738,851 (GRCm38) missense probably benign 0.00
Z1088:Lrrk2 UTSW 15 91,726,240 (GRCm38) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TTCTAACCACTAGAGGGCGC -3'
(R):5'- AGCAAATGGGAGCGTCATGC -3'

Sequencing Primer
(F):5'- GAAGAGGGCTCAGTCCATTTTCAC -3'
(R):5'- ATGCGGTGCCCTGCAGG -3'
Posted On 2022-07-18