Incidental Mutation 'R9491:Hectd4'
ID 716924
Institutional Source Beutler Lab
Gene Symbol Hectd4
Ensembl Gene ENSMUSG00000042744
Gene Name HECT domain E3 ubiquitin protein ligase 4
Synonyms Gm15800
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.927) question?
Stock # R9491 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 121358282-121506640 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 121452981 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 496 (L496R)
Ref Sequence ENSEMBL: ENSMUSP00000098332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042614] [ENSMUST00000100769]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000042614
AA Change: L1833R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744
AA Change: L1833R

DomainStartEndE-ValueType
low complexity region 224 234 N/A INTRINSIC
low complexity region 266 282 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 725 735 N/A INTRINSIC
low complexity region 1252 1265 N/A INTRINSIC
coiled coil region 1372 1398 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1725 1741 N/A INTRINSIC
low complexity region 1892 1904 N/A INTRINSIC
low complexity region 2656 2666 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
low complexity region 2901 2917 N/A INTRINSIC
low complexity region 2921 2933 N/A INTRINSIC
low complexity region 3232 3246 N/A INTRINSIC
low complexity region 3275 3335 N/A INTRINSIC
low complexity region 3441 3448 N/A INTRINSIC
low complexity region 3473 3506 N/A INTRINSIC
low complexity region 3512 3533 N/A INTRINSIC
low complexity region 3540 3554 N/A INTRINSIC
low complexity region 3794 3822 N/A INTRINSIC
HECTc 4048 4412 4.78e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100769
AA Change: L496R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098332
Gene: ENSMUSG00000042744
AA Change: L496R

DomainStartEndE-ValueType
coiled coil region 35 61 N/A INTRINSIC
low complexity region 214 225 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
low complexity region 555 567 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 G A 9: 106,312,994 (GRCm39) T142I probably damaging Het
Adcy9 T C 16: 4,236,052 (GRCm39) E453G probably damaging Het
Ank3 A C 10: 69,838,339 (GRCm39) probably null Het
Asmt G A X: 169,108,405 (GRCm39) G103D possibly damaging Het
Cap2 C T 13: 46,791,366 (GRCm39) P290S possibly damaging Het
Cfap43 A T 19: 47,800,505 (GRCm39) probably null Het
Clip2 C T 5: 134,533,616 (GRCm39) R487Q probably benign Het
Clstn1 T C 4: 149,731,929 (GRCm39) S950P probably damaging Het
Cluap1 G A 16: 3,758,732 (GRCm39) R398Q probably benign Het
Cmbl G T 15: 31,582,119 (GRCm39) V39L probably benign Het
Dapk1 A G 13: 60,877,369 (GRCm39) D536G probably benign Het
Ddx3y T A Y: 1,279,465 (GRCm39) D133V probably benign Het
Duox1 T A 2: 122,156,907 (GRCm39) S525T probably benign Het
Eif2s2 T C 2: 154,734,630 (GRCm39) probably benign Het
Foxo3 C T 10: 42,073,021 (GRCm39) V499M probably damaging Het
Gadd45a A T 6: 67,012,730 (GRCm39) D137E probably benign Het
Gmppa A G 1: 75,415,602 (GRCm39) D120G probably damaging Het
Gpr156 A T 16: 37,825,704 (GRCm39) R640S probably benign Het
Grik1 A T 16: 87,746,995 (GRCm39) M414K Het
Gtse1 C T 15: 85,755,734 (GRCm39) P466L probably damaging Het
H6pd T A 4: 150,080,366 (GRCm39) N160Y probably benign Het
Hnrnpk G T 13: 58,541,050 (GRCm39) Q441K probably benign Het
Incenp T C 19: 9,854,141 (GRCm39) K637E unknown Het
Irgc C T 7: 24,132,349 (GRCm39) R156H probably benign Het
Kazn C T 4: 141,845,436 (GRCm39) A383T Het
Lmln A G 16: 32,890,358 (GRCm39) E169G possibly damaging Het
Mcm5 C T 8: 75,844,168 (GRCm39) S313F probably benign Het
Mdfic T A 6: 15,799,852 (GRCm39) C326* probably null Het
Ncoa1 T A 12: 4,340,912 (GRCm39) D840V probably benign Het
Nkd1 A G 8: 89,300,875 (GRCm39) D81G probably benign Het
Or5an1c T C 19: 12,218,606 (GRCm39) T140A probably benign Het
Or8c10 T C 9: 38,278,971 (GRCm39) V33A possibly damaging Het
Parp4 G A 14: 56,832,828 (GRCm39) E384K probably damaging Het
Pcdhgb4 T A 18: 37,854,895 (GRCm39) L430H probably damaging Het
Pdgfrb A G 18: 61,212,056 (GRCm39) Y861C probably damaging Het
Pheta1 G A 5: 121,991,051 (GRCm39) A138T probably benign Het
Pipox T A 11: 77,772,359 (GRCm39) Y337F probably benign Het
Prcc A G 3: 87,774,671 (GRCm39) V377A probably benign Het
Prrg2 T A 7: 44,706,218 (GRCm39) Y133F probably damaging Het
Ptchd3 T C 11: 121,733,813 (GRCm39) V901A probably damaging Het
Rgl1 A G 1: 152,424,869 (GRCm39) L335P probably damaging Het
Setx T A 2: 29,037,835 (GRCm39) M1440K probably benign Het
Smchd1 A G 17: 71,667,020 (GRCm39) probably null Het
Tbpl2 T C 2: 23,986,532 (GRCm39) I6V probably benign Het
Tdrd12 T A 7: 35,188,689 (GRCm39) H516L Het
Tmem8b C T 4: 43,673,938 (GRCm39) R190C probably damaging Het
Tpmt A T 13: 47,180,752 (GRCm39) S196T probably benign Het
Trp63 A G 16: 25,695,472 (GRCm39) N478S unknown Het
Vstm5 T G 9: 15,168,586 (GRCm39) I50S probably damaging Het
Wdhd1 A T 14: 47,505,616 (GRCm39) C285* probably null Het
Zdhhc23 A C 16: 43,794,062 (GRCm39) V204G probably benign Het
Zfp653 T A 9: 21,969,622 (GRCm39) K215* probably null Het
Other mutations in Hectd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Hectd4 APN 5 121,501,933 (GRCm39) missense possibly damaging 0.51
IGL00976:Hectd4 APN 5 121,487,169 (GRCm39) missense probably benign 0.18
IGL01085:Hectd4 APN 5 121,469,764 (GRCm39) missense probably damaging 1.00
IGL01112:Hectd4 APN 5 121,445,013 (GRCm39) missense probably benign 0.01
IGL01402:Hectd4 APN 5 121,477,480 (GRCm39) splice site probably benign
IGL01474:Hectd4 APN 5 121,474,712 (GRCm39) missense possibly damaging 0.53
IGL01503:Hectd4 APN 5 121,456,714 (GRCm39) missense probably benign 0.28
IGL01548:Hectd4 APN 5 121,502,723 (GRCm39) missense possibly damaging 0.71
IGL01656:Hectd4 APN 5 121,460,763 (GRCm39) missense probably damaging 0.99
IGL01756:Hectd4 APN 5 121,482,887 (GRCm39) missense probably benign 0.28
IGL01819:Hectd4 APN 5 121,466,481 (GRCm39) missense possibly damaging 0.85
IGL02080:Hectd4 APN 5 121,504,669 (GRCm39) utr 3 prime probably benign
IGL02488:Hectd4 APN 5 121,430,150 (GRCm39) missense probably benign 0.33
IGL02490:Hectd4 APN 5 121,456,676 (GRCm39) missense possibly damaging 0.82
IGL02558:Hectd4 APN 5 121,482,848 (GRCm39) missense probably benign 0.28
IGL02626:Hectd4 APN 5 121,491,944 (GRCm39) missense possibly damaging 0.86
IGL02649:Hectd4 APN 5 121,487,465 (GRCm39) missense possibly damaging 0.73
IGL02736:Hectd4 APN 5 121,480,782 (GRCm39) missense possibly damaging 0.73
IGL02861:Hectd4 APN 5 121,445,067 (GRCm39) missense possibly damaging 0.81
IGL02880:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL02889:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL02953:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL02969:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL03031:Hectd4 APN 5 121,486,857 (GRCm39) missense possibly damaging 0.96
IGL03066:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL03160:Hectd4 APN 5 121,397,942 (GRCm39) missense probably benign
IGL03181:Hectd4 APN 5 121,492,021 (GRCm39) missense possibly damaging 0.91
IGL03265:Hectd4 APN 5 121,398,002 (GRCm39) splice site probably benign
IGL03375:Hectd4 APN 5 121,466,445 (GRCm39) missense possibly damaging 0.72
Achilles UTSW 5 121,445,444 (GRCm39) nonsense probably null
agamemnon UTSW 5 121,391,921 (GRCm39) splice site probably benign
clymnestra UTSW 5 121,472,438 (GRCm39) missense possibly damaging 0.86
hector UTSW 5 121,453,500 (GRCm39) missense probably damaging 1.00
helen UTSW 5 121,448,726 (GRCm39) missense probably damaging 0.97
Merriwether UTSW 5 121,491,614 (GRCm39) missense possibly damaging 0.53
PIT4466001:Hectd4 UTSW 5 121,471,123 (GRCm39) critical splice donor site probably null
R0018:Hectd4 UTSW 5 121,392,242 (GRCm39) missense possibly damaging 0.53
R0024:Hectd4 UTSW 5 121,446,639 (GRCm39) missense possibly damaging 0.92
R0030:Hectd4 UTSW 5 121,400,651 (GRCm39) nonsense probably null
R0080:Hectd4 UTSW 5 121,487,435 (GRCm39) missense probably benign 0.18
R0110:Hectd4 UTSW 5 121,443,736 (GRCm39) missense possibly damaging 0.53
R0110:Hectd4 UTSW 5 121,419,959 (GRCm39) missense possibly damaging 0.90
R0115:Hectd4 UTSW 5 121,433,569 (GRCm39) splice site probably benign
R0128:Hectd4 UTSW 5 121,487,306 (GRCm39) missense possibly damaging 0.86
R0131:Hectd4 UTSW 5 121,471,087 (GRCm39) missense probably benign 0.44
R0131:Hectd4 UTSW 5 121,471,087 (GRCm39) missense probably benign 0.44
R0132:Hectd4 UTSW 5 121,471,087 (GRCm39) missense probably benign 0.44
R0244:Hectd4 UTSW 5 121,467,668 (GRCm39) missense probably benign 0.33
R0281:Hectd4 UTSW 5 121,392,314 (GRCm39) missense possibly damaging 0.85
R0329:Hectd4 UTSW 5 121,397,927 (GRCm39) missense probably benign
R0410:Hectd4 UTSW 5 121,424,329 (GRCm39) missense possibly damaging 0.86
R0422:Hectd4 UTSW 5 121,481,145 (GRCm39) splice site probably null
R0442:Hectd4 UTSW 5 121,462,045 (GRCm39) missense possibly damaging 0.66
R0449:Hectd4 UTSW 5 121,502,653 (GRCm39) splice site probably null
R0469:Hectd4 UTSW 5 121,443,736 (GRCm39) missense possibly damaging 0.53
R0469:Hectd4 UTSW 5 121,419,959 (GRCm39) missense possibly damaging 0.90
R0481:Hectd4 UTSW 5 121,433,569 (GRCm39) splice site probably benign
R0510:Hectd4 UTSW 5 121,443,736 (GRCm39) missense possibly damaging 0.53
R0510:Hectd4 UTSW 5 121,419,959 (GRCm39) missense possibly damaging 0.90
R0520:Hectd4 UTSW 5 121,469,770 (GRCm39) missense possibly damaging 0.53
R0534:Hectd4 UTSW 5 121,486,539 (GRCm39) missense possibly damaging 0.96
R0603:Hectd4 UTSW 5 121,442,400 (GRCm39) missense possibly damaging 0.46
R0617:Hectd4 UTSW 5 121,481,295 (GRCm39) splice site probably benign
R0622:Hectd4 UTSW 5 121,486,688 (GRCm39) missense possibly damaging 0.53
R0626:Hectd4 UTSW 5 121,415,887 (GRCm39) missense probably benign 0.18
R0708:Hectd4 UTSW 5 121,424,526 (GRCm39) critical splice donor site probably null
R0710:Hectd4 UTSW 5 121,474,691 (GRCm39) missense probably benign 0.08
R0763:Hectd4 UTSW 5 121,445,096 (GRCm39) unclassified probably benign
R0764:Hectd4 UTSW 5 121,424,832 (GRCm39) missense possibly damaging 0.46
R1123:Hectd4 UTSW 5 121,424,799 (GRCm39) missense probably damaging 0.96
R1129:Hectd4 UTSW 5 121,448,662 (GRCm39) missense possibly damaging 0.66
R1204:Hectd4 UTSW 5 121,488,548 (GRCm39) missense possibly damaging 0.85
R1237:Hectd4 UTSW 5 121,459,570 (GRCm39) missense possibly damaging 0.90
R1257:Hectd4 UTSW 5 121,456,687 (GRCm39) nonsense probably null
R1391:Hectd4 UTSW 5 121,491,758 (GRCm39) missense possibly damaging 0.96
R1395:Hectd4 UTSW 5 121,466,576 (GRCm39) critical splice donor site probably null
R1468:Hectd4 UTSW 5 121,487,235 (GRCm39) missense possibly damaging 0.65
R1468:Hectd4 UTSW 5 121,487,235 (GRCm39) missense possibly damaging 0.65
R1545:Hectd4 UTSW 5 121,462,019 (GRCm39) missense possibly damaging 0.87
R1553:Hectd4 UTSW 5 121,487,322 (GRCm39) missense probably benign 0.00
R1572:Hectd4 UTSW 5 121,439,941 (GRCm39) missense possibly damaging 0.85
R1662:Hectd4 UTSW 5 121,455,308 (GRCm39) missense probably benign 0.01
R1705:Hectd4 UTSW 5 121,436,167 (GRCm39) missense probably benign
R1715:Hectd4 UTSW 5 121,482,881 (GRCm39) missense possibly damaging 0.85
R1728:Hectd4 UTSW 5 121,439,902 (GRCm39) missense possibly damaging 0.51
R1736:Hectd4 UTSW 5 121,487,593 (GRCm39) missense possibly damaging 0.53
R1768:Hectd4 UTSW 5 121,496,366 (GRCm39) missense possibly damaging 0.70
R1775:Hectd4 UTSW 5 121,429,254 (GRCm39) splice site probably benign
R1784:Hectd4 UTSW 5 121,439,902 (GRCm39) missense possibly damaging 0.51
R1843:Hectd4 UTSW 5 121,435,243 (GRCm39) missense possibly damaging 0.53
R1914:Hectd4 UTSW 5 121,460,357 (GRCm39) missense probably benign 0.08
R1915:Hectd4 UTSW 5 121,460,357 (GRCm39) missense probably benign 0.08
R2024:Hectd4 UTSW 5 121,419,981 (GRCm39) missense possibly damaging 0.86
R2103:Hectd4 UTSW 5 121,493,692 (GRCm39) missense probably benign 0.04
R2108:Hectd4 UTSW 5 121,471,487 (GRCm39) missense possibly damaging 0.72
R2124:Hectd4 UTSW 5 121,456,702 (GRCm39) missense probably damaging 0.97
R2150:Hectd4 UTSW 5 121,391,921 (GRCm39) splice site probably benign
R2192:Hectd4 UTSW 5 121,453,206 (GRCm39) missense possibly damaging 0.46
R2301:Hectd4 UTSW 5 121,491,600 (GRCm39) missense probably benign 0.18
R2324:Hectd4 UTSW 5 121,453,500 (GRCm39) missense probably damaging 1.00
R2331:Hectd4 UTSW 5 121,458,089 (GRCm39) missense probably benign 0.05
R2504:Hectd4 UTSW 5 121,402,030 (GRCm39) missense possibly damaging 0.73
R2504:Hectd4 UTSW 5 121,358,683 (GRCm39) missense unknown
R2904:Hectd4 UTSW 5 121,430,787 (GRCm39) splice site probably benign
R3843:Hectd4 UTSW 5 121,397,936 (GRCm39) missense possibly damaging 0.72
R3934:Hectd4 UTSW 5 121,458,164 (GRCm39) critical splice donor site probably null
R3944:Hectd4 UTSW 5 121,441,588 (GRCm39) splice site probably benign
R4133:Hectd4 UTSW 5 121,415,897 (GRCm39) critical splice donor site probably null
R4271:Hectd4 UTSW 5 121,358,567 (GRCm39) small deletion probably benign
R4413:Hectd4 UTSW 5 121,488,544 (GRCm39) missense possibly damaging 0.53
R4456:Hectd4 UTSW 5 121,446,334 (GRCm39) missense possibly damaging 0.65
R4489:Hectd4 UTSW 5 121,424,320 (GRCm39) missense possibly damaging 0.73
R4539:Hectd4 UTSW 5 121,452,970 (GRCm39) nonsense probably null
R4564:Hectd4 UTSW 5 121,488,494 (GRCm39) missense probably benign 0.33
R4582:Hectd4 UTSW 5 121,424,482 (GRCm39) missense possibly damaging 0.53
R4629:Hectd4 UTSW 5 121,435,266 (GRCm39) missense probably benign 0.01
R4633:Hectd4 UTSW 5 121,487,279 (GRCm39) missense probably benign 0.33
R4643:Hectd4 UTSW 5 121,487,118 (GRCm39) missense possibly damaging 0.53
R4679:Hectd4 UTSW 5 121,463,314 (GRCm39) missense possibly damaging 0.72
R4681:Hectd4 UTSW 5 121,441,678 (GRCm39) missense possibly damaging 0.86
R4734:Hectd4 UTSW 5 121,480,040 (GRCm39) missense possibly damaging 0.53
R4739:Hectd4 UTSW 5 121,486,505 (GRCm39) missense probably benign
R4781:Hectd4 UTSW 5 121,444,170 (GRCm39) critical splice donor site probably null
R4860:Hectd4 UTSW 5 121,443,881 (GRCm39) missense probably benign 0.04
R4860:Hectd4 UTSW 5 121,443,881 (GRCm39) missense probably benign 0.04
R4869:Hectd4 UTSW 5 121,460,735 (GRCm39) missense possibly damaging 0.46
R4909:Hectd4 UTSW 5 121,401,954 (GRCm39) missense probably benign 0.18
R4922:Hectd4 UTSW 5 121,497,378 (GRCm39) missense possibly damaging 0.86
R4925:Hectd4 UTSW 5 121,460,753 (GRCm39) missense possibly damaging 0.83
R5004:Hectd4 UTSW 5 121,467,628 (GRCm39) missense possibly damaging 0.93
R5004:Hectd4 UTSW 5 121,466,262 (GRCm39) splice site probably null
R5129:Hectd4 UTSW 5 121,481,573 (GRCm39) missense possibly damaging 0.87
R5217:Hectd4 UTSW 5 121,491,614 (GRCm39) missense possibly damaging 0.53
R5267:Hectd4 UTSW 5 121,482,887 (GRCm39) missense probably benign 0.28
R5344:Hectd4 UTSW 5 121,481,739 (GRCm39) missense probably benign 0.28
R5345:Hectd4 UTSW 5 121,402,037 (GRCm39) missense possibly damaging 0.85
R5347:Hectd4 UTSW 5 121,442,511 (GRCm39) missense probably benign 0.33
R5360:Hectd4 UTSW 5 121,453,464 (GRCm39) missense possibly damaging 0.90
R5363:Hectd4 UTSW 5 121,448,666 (GRCm39) missense probably benign 0.04
R5445:Hectd4 UTSW 5 121,404,337 (GRCm39) missense probably benign 0.00
R5479:Hectd4 UTSW 5 121,445,011 (GRCm39) missense probably benign
R5507:Hectd4 UTSW 5 121,419,164 (GRCm39) missense unknown
R5552:Hectd4 UTSW 5 121,480,914 (GRCm39) missense possibly damaging 0.96
R5691:Hectd4 UTSW 5 121,486,878 (GRCm39) missense possibly damaging 0.85
R5745:Hectd4 UTSW 5 121,491,565 (GRCm39) missense possibly damaging 0.96
R5757:Hectd4 UTSW 5 121,486,682 (GRCm39) missense possibly damaging 0.72
R5845:Hectd4 UTSW 5 121,445,587 (GRCm39) critical splice donor site probably null
R5869:Hectd4 UTSW 5 121,481,288 (GRCm39) critical splice donor site probably null
R5913:Hectd4 UTSW 5 121,462,037 (GRCm39) missense possibly damaging 0.83
R5920:Hectd4 UTSW 5 121,446,334 (GRCm39) missense possibly damaging 0.65
R5943:Hectd4 UTSW 5 121,460,357 (GRCm39) missense probably benign 0.01
R6219:Hectd4 UTSW 5 121,446,941 (GRCm39) missense possibly damaging 0.92
R6250:Hectd4 UTSW 5 121,477,561 (GRCm39) missense possibly damaging 0.85
R6301:Hectd4 UTSW 5 121,392,283 (GRCm39) missense possibly damaging 0.91
R6428:Hectd4 UTSW 5 121,488,508 (GRCm39) missense possibly damaging 0.53
R6446:Hectd4 UTSW 5 121,472,438 (GRCm39) missense possibly damaging 0.86
R6453:Hectd4 UTSW 5 121,488,655 (GRCm39) missense probably damaging 1.00
R6513:Hectd4 UTSW 5 121,494,259 (GRCm39) splice site probably null
R6540:Hectd4 UTSW 5 121,441,634 (GRCm39) missense probably benign 0.33
R6706:Hectd4 UTSW 5 121,458,147 (GRCm39) missense possibly damaging 0.92
R6720:Hectd4 UTSW 5 121,445,444 (GRCm39) nonsense probably null
R6736:Hectd4 UTSW 5 121,415,788 (GRCm39) missense possibly damaging 0.86
R6776:Hectd4 UTSW 5 121,491,574 (GRCm39) missense possibly damaging 0.85
R7033:Hectd4 UTSW 5 121,502,631 (GRCm39) missense possibly damaging 0.86
R7038:Hectd4 UTSW 5 121,437,660 (GRCm39) missense possibly damaging 0.90
R7175:Hectd4 UTSW 5 121,411,692 (GRCm39) missense possibly damaging 0.85
R7180:Hectd4 UTSW 5 121,446,405 (GRCm39) missense probably benign 0.01
R7234:Hectd4 UTSW 5 121,467,136 (GRCm39) missense possibly damaging 0.53
R7253:Hectd4 UTSW 5 121,452,944 (GRCm39) missense possibly damaging 0.66
R7349:Hectd4 UTSW 5 121,448,726 (GRCm39) missense probably damaging 0.97
R7450:Hectd4 UTSW 5 121,419,995 (GRCm39) missense probably benign 0.00
R7467:Hectd4 UTSW 5 121,462,024 (GRCm39) missense possibly damaging 0.66
R7475:Hectd4 UTSW 5 121,496,196 (GRCm39) splice site probably null
R7482:Hectd4 UTSW 5 121,501,941 (GRCm39) missense possibly damaging 0.71
R7512:Hectd4 UTSW 5 121,435,172 (GRCm39) missense possibly damaging 0.72
R7525:Hectd4 UTSW 5 121,481,728 (GRCm39) missense possibly damaging 0.70
R7559:Hectd4 UTSW 5 121,453,573 (GRCm39) splice site probably null
R7560:Hectd4 UTSW 5 121,392,405 (GRCm39) missense possibly damaging 0.53
R7561:Hectd4 UTSW 5 121,429,288 (GRCm39) missense possibly damaging 0.91
R7576:Hectd4 UTSW 5 121,487,522 (GRCm39) missense possibly damaging 0.91
R7584:Hectd4 UTSW 5 121,456,798 (GRCm39) missense possibly damaging 0.83
R7648:Hectd4 UTSW 5 121,392,434 (GRCm39) missense possibly damaging 0.73
R7663:Hectd4 UTSW 5 121,462,094 (GRCm39) missense probably benign 0.06
R7692:Hectd4 UTSW 5 121,459,627 (GRCm39) missense possibly damaging 0.46
R7725:Hectd4 UTSW 5 121,358,680 (GRCm39) missense unknown
R7731:Hectd4 UTSW 5 121,445,077 (GRCm39) missense probably benign 0.00
R7732:Hectd4 UTSW 5 121,474,692 (GRCm39) missense probably benign 0.14
R7782:Hectd4 UTSW 5 121,443,784 (GRCm39) missense possibly damaging 0.53
R7854:Hectd4 UTSW 5 121,467,631 (GRCm39) missense probably benign 0.27
R7898:Hectd4 UTSW 5 121,469,880 (GRCm39) missense probably benign 0.18
R7910:Hectd4 UTSW 5 121,392,291 (GRCm39) missense possibly damaging 0.86
R7962:Hectd4 UTSW 5 121,448,692 (GRCm39) missense probably damaging 0.98
R8003:Hectd4 UTSW 5 121,477,581 (GRCm39) missense possibly damaging 0.85
R8098:Hectd4 UTSW 5 121,459,461 (GRCm39) missense possibly damaging 0.46
R8110:Hectd4 UTSW 5 121,471,012 (GRCm39) missense possibly damaging 0.96
R8118:Hectd4 UTSW 5 121,424,439 (GRCm39) missense probably benign 0.33
R8171:Hectd4 UTSW 5 121,456,819 (GRCm39) missense possibly damaging 0.82
R8234:Hectd4 UTSW 5 121,477,607 (GRCm39) missense possibly damaging 0.72
R8289:Hectd4 UTSW 5 121,404,424 (GRCm39) missense possibly damaging 0.53
R8292:Hectd4 UTSW 5 121,455,288 (GRCm39) missense possibly damaging 0.66
R8348:Hectd4 UTSW 5 121,358,319 (GRCm39) start gained probably benign
R8397:Hectd4 UTSW 5 121,397,957 (GRCm39) missense probably damaging 0.98
R8436:Hectd4 UTSW 5 121,481,210 (GRCm39) missense probably benign 0.00
R8436:Hectd4 UTSW 5 121,446,421 (GRCm39) missense possibly damaging 0.90
R8443:Hectd4 UTSW 5 121,467,172 (GRCm39) missense possibly damaging 0.72
R8448:Hectd4 UTSW 5 121,358,319 (GRCm39) start gained probably benign
R8516:Hectd4 UTSW 5 121,487,073 (GRCm39) missense possibly damaging 0.53
R8519:Hectd4 UTSW 5 121,442,489 (GRCm39) nonsense probably null
R8553:Hectd4 UTSW 5 121,491,661 (GRCm39) missense possibly damaging 0.73
R8557:Hectd4 UTSW 5 121,448,714 (GRCm39) missense possibly damaging 0.66
R8725:Hectd4 UTSW 5 121,488,557 (GRCm39) missense probably damaging 1.00
R8751:Hectd4 UTSW 5 121,501,838 (GRCm39) nonsense probably null
R8769:Hectd4 UTSW 5 121,419,936 (GRCm39) missense possibly damaging 0.53
R8803:Hectd4 UTSW 5 121,461,994 (GRCm39) missense probably benign 0.01
R8887:Hectd4 UTSW 5 121,433,541 (GRCm39) missense probably benign 0.44
R8982:Hectd4 UTSW 5 121,466,305 (GRCm39) missense probably benign 0.02
R8988:Hectd4 UTSW 5 121,415,819 (GRCm39) missense possibly damaging 0.86
R8991:Hectd4 UTSW 5 121,496,347 (GRCm39) missense probably benign 0.33
R8994:Hectd4 UTSW 5 121,441,629 (GRCm39) missense probably benign 0.33
R8995:Hectd4 UTSW 5 121,392,422 (GRCm39) missense possibly damaging 0.96
R9049:Hectd4 UTSW 5 121,451,955 (GRCm39) missense possibly damaging 0.92
R9093:Hectd4 UTSW 5 121,411,677 (GRCm39) missense probably benign 0.14
R9106:Hectd4 UTSW 5 121,467,619 (GRCm39) missense possibly damaging 0.53
R9137:Hectd4 UTSW 5 121,496,238 (GRCm39) missense possibly damaging 0.53
R9146:Hectd4 UTSW 5 121,487,097 (GRCm39) missense probably benign 0.33
R9154:Hectd4 UTSW 5 121,391,967 (GRCm39) missense
R9162:Hectd4 UTSW 5 121,445,042 (GRCm39) missense possibly damaging 0.66
R9166:Hectd4 UTSW 5 121,446,690 (GRCm39) missense probably damaging 0.96
R9183:Hectd4 UTSW 5 121,437,551 (GRCm39) missense possibly damaging 0.51
R9207:Hectd4 UTSW 5 121,433,496 (GRCm39) missense possibly damaging 0.86
R9291:Hectd4 UTSW 5 121,487,028 (GRCm39) missense probably benign 0.14
R9300:Hectd4 UTSW 5 121,486,952 (GRCm39) missense probably benign 0.33
R9314:Hectd4 UTSW 5 121,437,708 (GRCm39) critical splice donor site probably null
R9381:Hectd4 UTSW 5 121,472,492 (GRCm39) missense possibly damaging 0.53
R9432:Hectd4 UTSW 5 121,460,864 (GRCm39) missense probably benign 0.01
R9532:Hectd4 UTSW 5 121,502,616 (GRCm39) missense probably benign 0.00
R9557:Hectd4 UTSW 5 121,459,617 (GRCm39) missense possibly damaging 0.66
R9561:Hectd4 UTSW 5 121,472,532 (GRCm39) missense possibly damaging 0.53
R9593:Hectd4 UTSW 5 121,424,844 (GRCm39) nonsense probably null
R9704:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9705:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9712:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9713:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9726:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9732:Hectd4 UTSW 5 121,392,254 (GRCm39) nonsense probably null
R9750:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9752:Hectd4 UTSW 5 121,472,415 (GRCm39) missense possibly damaging 0.85
R9752:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9772:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
X0026:Hectd4 UTSW 5 121,487,700 (GRCm39) missense probably benign 0.04
X0027:Hectd4 UTSW 5 121,459,467 (GRCm39) missense probably benign 0.27
Z1088:Hectd4 UTSW 5 121,433,566 (GRCm39) splice site probably null
Z1177:Hectd4 UTSW 5 121,496,383 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGGTCAGTTTTATGAGCACC -3'
(R):5'- TCCCAGACTATCCTGATGGAC -3'

Sequencing Primer
(F):5'- GAGCACCTATTAAATATTTGCTGCAG -3'
(R):5'- ACATAGTCTGCCAGCTTGG -3'
Posted On 2022-07-18