Incidental Mutation 'R9492:Dpp10'
ID 716968
Institutional Source Beutler Lab
Gene Symbol Dpp10
Ensembl Gene ENSMUSG00000036815
Gene Name dipeptidylpeptidase 10
Synonyms 6430601K09Rik, DPRP3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9492 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 123321471-124045559 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123353430 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 630 (D630G)
Ref Sequence ENSEMBL: ENSMUSP00000108225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112603] [ENSMUST00000112606]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000112603
AA Change: D619G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108222
Gene: ENSMUSG00000036815
AA Change: D619G

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:DPPIV_N 83 450 4.9e-118 PFAM
Pfam:Peptidase_S9 530 734 6.4e-47 PFAM
Pfam:DLH 556 711 1.4e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112606
AA Change: D630G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108225
Gene: ENSMUSG00000036815
AA Change: D630G

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:DPPIV_N 137 504 4.4e-115 PFAM
Pfam:Peptidase_S9 584 788 8.6e-48 PFAM
Pfam:DLH 604 774 1.1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A C 1: 120,150,742 K43T probably damaging Het
Abca12 A G 1: 71,258,221 V2370A possibly damaging Het
Abca13 T A 11: 9,293,667 C1843* probably null Het
Abr C T 11: 76,508,925 S82N probably benign Het
Acot2 T C 12: 83,992,610 S298P probably benign Het
Acrbp A G 6: 125,061,099 D421G probably benign Het
Adam25 A T 8: 40,753,699 M1L probably benign Het
Ano8 A G 8: 71,482,140 V441A possibly damaging Het
Atg2b T C 12: 105,658,290 H650R probably benign Het
Atp11a C T 8: 12,844,490 T695I probably damaging Het
AU018091 A G 7: 3,164,193 S74P probably benign Het
Cadps2 A G 6: 23,427,239 Y597H probably benign Het
Ccdc15 C T 9: 37,304,369 E619K probably damaging Het
Ceacam11 G T 7: 17,975,543 C222F probably benign Het
Cmya5 T C 13: 93,041,314 *3677W probably null Het
Col11a1 G C 3: 114,212,103 C1628S probably benign Het
Dhx8 T C 11: 101,763,982 I1032T possibly damaging Het
Doxl2 T C 6: 48,978,606 S717P probably benign Het
Eci3 C T 13: 34,959,993 G50R probably benign Het
Eif2a A G 3: 58,541,054 T103A probably benign Het
Frem1 T C 4: 83,001,820 E432G probably damaging Het
Gdnf C T 15: 7,810,942 probably benign Het
Hace1 T A 10: 45,671,134 M471K probably benign Het
Hydin A G 8: 110,600,245 T4739A possibly damaging Het
Ilf2 A G 3: 90,487,263 I320V probably benign Het
Iqgap3 C A 3: 88,108,869 F986L probably damaging Het
Klhl21 T C 4: 152,008,962 L7S probably benign Het
Lrrc61 G T 6: 48,568,827 E195* probably null Het
Maz G T 7: 127,023,120 A443E possibly damaging Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Mtor T A 4: 148,484,344 L1107Q probably damaging Het
Nectin3 T C 16: 46,395,148 H494R probably benign Het
Nlgn1 G T 3: 25,434,316 Y618* probably null Het
Nup98 C T 7: 102,129,045 E1372K probably benign Het
Olfr1121 A G 2: 87,371,616 N28S probably benign Het
Olfr312 T C 11: 58,831,784 V210A probably benign Het
Otud6b A G 4: 14,818,349 I184T probably damaging Het
Pcsk6 A G 7: 66,047,598 N891S probably benign Het
Pde4a T A 9: 21,194,800 L237Q probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pou3f1 A G 4: 124,658,386 H227R possibly damaging Het
Prss53 G A 7: 127,889,630 R31C probably damaging Het
Psmb8 T A 17: 34,198,461 D21E probably benign Het
Ptprq A G 10: 107,642,952 Y1277H probably damaging Het
Rexo2 T C 9: 48,468,876 T219A probably benign Het
Rfc3 A G 5: 151,642,946 F346S probably damaging Het
Rhoq A T 17: 86,996,945 Q168L Het
Sgk1 A G 10: 21,998,197 N452S probably damaging Het
Slc35f3 A G 8: 126,321,287 K122R probably damaging Het
Slc4a2 T A 5: 24,439,763 M1021K probably benign Het
Sorcs2 A G 5: 36,029,140 V886A probably benign Het
Spata20 T A 11: 94,483,618 M308L probably damaging Het
Spen A T 4: 141,471,787 H3176Q probably benign Het
Stat5b T A 11: 100,801,535 H141L probably benign Het
Syne2 T A 12: 75,949,065 H2126Q possibly damaging Het
Traj46 A G 14: 54,172,394 T20A Het
Trim30a G T 7: 104,429,123 Q249K probably damaging Het
Trmt13 A G 3: 116,594,632 Y52H probably benign Het
Trpv3 A G 11: 73,296,441 I700V probably damaging Het
Tyr G A 7: 87,472,496 H363Y probably damaging Het
Tyr C G 7: 87,472,497 M362I possibly damaging Het
Ubb G A 11: 62,552,158 V5M probably damaging Het
Unc5a T C 13: 55,002,475 L519P probably damaging Het
Uso1 A G 5: 92,167,332 D185G possibly damaging Het
Vmn1r228 C T 17: 20,776,600 E219K probably damaging Het
Wdr49 A G 3: 75,333,362 V400A probably damaging Het
Zfp292 A G 4: 34,810,794 M755T probably benign Het
Other mutations in Dpp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Dpp10 APN 1 123334370 missense probably damaging 1.00
IGL01618:Dpp10 APN 1 123367867 missense probably benign
IGL02101:Dpp10 APN 1 123411826 missense probably damaging 1.00
IGL02284:Dpp10 APN 1 124045366 splice site probably benign
IGL02324:Dpp10 APN 1 123367802 missense probably benign 0.02
IGL02391:Dpp10 APN 1 123650358 missense probably damaging 0.98
IGL02458:Dpp10 APN 1 123341689 missense probably benign 0.01
IGL02469:Dpp10 APN 1 123411803 missense probably benign 0.01
IGL02501:Dpp10 APN 1 123686270 missense possibly damaging 0.93
IGL02522:Dpp10 APN 1 123423652 missense probably benign 0.24
IGL02672:Dpp10 APN 1 123376647 missense probably benign 0.45
IGL03034:Dpp10 APN 1 123341619 missense probably damaging 1.00
PIT1430001:Dpp10 UTSW 1 123341182 splice site probably benign
R0104:Dpp10 UTSW 1 123367843 missense probably benign 0.00
R0114:Dpp10 UTSW 1 123486092 missense probably benign 0.07
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0682:Dpp10 UTSW 1 123905125 missense probably damaging 0.98
R0815:Dpp10 UTSW 1 123432929 critical splice donor site probably null
R1549:Dpp10 UTSW 1 123341380 critical splice acceptor site probably null
R1742:Dpp10 UTSW 1 123445206 missense probably damaging 1.00
R1859:Dpp10 UTSW 1 123353604 missense possibly damaging 0.47
R1991:Dpp10 UTSW 1 123905106 missense probably null 1.00
R1992:Dpp10 UTSW 1 123905106 missense probably null 1.00
R2079:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
R2882:Dpp10 UTSW 1 123445203 missense probably damaging 1.00
R2974:Dpp10 UTSW 1 123411705 splice site probably benign
R3827:Dpp10 UTSW 1 123411790 missense possibly damaging 0.56
R3852:Dpp10 UTSW 1 123485924 nonsense probably null
R3876:Dpp10 UTSW 1 123353487 missense probably damaging 0.98
R3899:Dpp10 UTSW 1 123353557 missense probably damaging 1.00
R4735:Dpp10 UTSW 1 123398627 missense probably benign 0.15
R4922:Dpp10 UTSW 1 123378153 missense probably benign 0.44
R5457:Dpp10 UTSW 1 123411810 missense possibly damaging 0.51
R5599:Dpp10 UTSW 1 123905076 missense probably damaging 0.99
R5913:Dpp10 UTSW 1 123384289 missense probably damaging 1.00
R5979:Dpp10 UTSW 1 123384283 critical splice donor site probably null
R6378:Dpp10 UTSW 1 123411739 missense probably damaging 1.00
R6429:Dpp10 UTSW 1 123367601 missense possibly damaging 0.72
R6505:Dpp10 UTSW 1 123336851 missense probably damaging 0.99
R6776:Dpp10 UTSW 1 123367656 nonsense probably null
R6894:Dpp10 UTSW 1 123336864 missense probably damaging 1.00
R6951:Dpp10 UTSW 1 123341650 missense possibly damaging 0.93
R7182:Dpp10 UTSW 1 123341151 missense probably benign 0.15
R7246:Dpp10 UTSW 1 123334377 missense probably damaging 1.00
R7297:Dpp10 UTSW 1 123353428 nonsense probably null
R7375:Dpp10 UTSW 1 123367795 missense probably benign
R7387:Dpp10 UTSW 1 123341140 missense probably benign 0.01
R7661:Dpp10 UTSW 1 123384952 missense probably damaging 1.00
R8065:Dpp10 UTSW 1 123352660 missense probably benign
R8067:Dpp10 UTSW 1 123352660 missense probably benign
R8260:Dpp10 UTSW 1 123686295 missense probably benign
R8324:Dpp10 UTSW 1 123854172 missense probably benign 0.02
R8373:Dpp10 UTSW 1 123854229 missense possibly damaging 0.94
R8434:Dpp10 UTSW 1 123433010 missense probably damaging 1.00
R9068:Dpp10 UTSW 1 123432938 missense probably damaging 1.00
R9104:Dpp10 UTSW 1 123411755 missense probably damaging 1.00
R9477:Dpp10 UTSW 1 123376641 missense possibly damaging 0.46
R9524:Dpp10 UTSW 1 123336882 missense probably damaging 1.00
R9576:Dpp10 UTSW 1 123341680 missense probably damaging 1.00
R9631:Dpp10 UTSW 1 123341703 missense probably damaging 1.00
R9736:Dpp10 UTSW 1 123334359 missense possibly damaging 0.64
X0019:Dpp10 UTSW 1 123398585 missense possibly damaging 0.88
X0020:Dpp10 UTSW 1 123398582 missense probably benign 0.36
X0021:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
X0024:Dpp10 UTSW 1 123384286 missense probably damaging 1.00
Z1176:Dpp10 UTSW 1 123353440 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACACCAATAACAGTGATAGATGC -3'
(R):5'- CTGCTGAAATGCTGGTTGCC -3'

Sequencing Primer
(F):5'- TGCTTTTAAAAATGCAAGAAAGCTAC -3'
(R):5'- CTCATATTTGCAGGGATGAAGAACC -3'
Posted On 2022-07-18