Incidental Mutation 'R9492:Vmn1r228'
ID 717032
Institutional Source Beutler Lab
Gene Symbol Vmn1r228
Ensembl Gene ENSMUSG00000060245
Gene Name vomeronasal 1 receptor 228
Synonyms V1re3
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R9492 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 20996321-20997763 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 20996862 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 219 (E219K)
Ref Sequence ENSEMBL: ENSMUSP00000072243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072410]
AlphaFold Q8R2A7
Predicted Effect probably damaging
Transcript: ENSMUST00000072410
AA Change: E219K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072243
Gene: ENSMUSG00000060245
AA Change: E219K

DomainStartEndE-ValueType
Pfam:TAS2R 32 317 2.6e-11 PFAM
Pfam:7tm_1 53 316 2.6e-9 PFAM
Pfam:V1R 63 321 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A C 1: 120,078,472 (GRCm39) K43T probably damaging Het
Abca12 A G 1: 71,297,380 (GRCm39) V2370A possibly damaging Het
Abca13 T A 11: 9,243,667 (GRCm39) C1843* probably null Het
Abr C T 11: 76,399,751 (GRCm39) S82N probably benign Het
Acot2 T C 12: 84,039,384 (GRCm39) S298P probably benign Het
Acrbp A G 6: 125,038,062 (GRCm39) D421G probably benign Het
Adam25 A T 8: 41,206,736 (GRCm39) M1L probably benign Het
Ano8 A G 8: 71,934,784 (GRCm39) V441A possibly damaging Het
Aoc1l1 T C 6: 48,955,540 (GRCm39) S717P probably benign Het
Atg2b T C 12: 105,624,549 (GRCm39) H650R probably benign Het
Atp11a C T 8: 12,894,490 (GRCm39) T695I probably damaging Het
AU018091 A G 7: 3,214,023 (GRCm39) S74P probably benign Het
Cadps2 A G 6: 23,427,238 (GRCm39) Y597H probably benign Het
Ccdc15 C T 9: 37,215,665 (GRCm39) E619K probably damaging Het
Ceacam11 G T 7: 17,709,468 (GRCm39) C222F probably benign Het
Cmya5 T C 13: 93,177,822 (GRCm39) *3677W probably null Het
Col11a1 G C 3: 114,005,752 (GRCm39) C1628S probably benign Het
Dhx8 T C 11: 101,654,808 (GRCm39) I1032T possibly damaging Het
Dpp10 T C 1: 123,281,159 (GRCm39) D630G probably damaging Het
Eci3 C T 13: 35,143,976 (GRCm39) G50R probably benign Het
Eif2a A G 3: 58,448,475 (GRCm39) T103A probably benign Het
Frem1 T C 4: 82,920,057 (GRCm39) E432G probably damaging Het
Gdnf C T 15: 7,840,423 (GRCm39) probably benign Het
Hace1 T A 10: 45,547,230 (GRCm39) M471K probably benign Het
Hydin A G 8: 111,326,877 (GRCm39) T4739A possibly damaging Het
Ilf2 A G 3: 90,394,570 (GRCm39) I320V probably benign Het
Iqgap3 C A 3: 88,016,176 (GRCm39) F986L probably damaging Het
Klhl21 T C 4: 152,093,419 (GRCm39) L7S probably benign Het
Lrrc61 G T 6: 48,545,761 (GRCm39) E195* probably null Het
Maz G T 7: 126,622,292 (GRCm39) A443E possibly damaging Het
Mcm5 C T 8: 75,844,168 (GRCm39) S313F probably benign Het
Mtor T A 4: 148,568,801 (GRCm39) L1107Q probably damaging Het
Nectin3 T C 16: 46,215,511 (GRCm39) H494R probably benign Het
Nlgn1 G T 3: 25,488,480 (GRCm39) Y618* probably null Het
Nup98 C T 7: 101,778,252 (GRCm39) E1372K probably benign Het
Or12e9 A G 2: 87,201,960 (GRCm39) N28S probably benign Het
Or5af1 T C 11: 58,722,610 (GRCm39) V210A probably benign Het
Otud6b A G 4: 14,818,349 (GRCm39) I184T probably damaging Het
Pcsk6 A G 7: 65,697,346 (GRCm39) N891S probably benign Het
Pde4a T A 9: 21,106,096 (GRCm39) L237Q probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,302,525 (GRCm39) probably benign Het
Pou3f1 A G 4: 124,552,179 (GRCm39) H227R possibly damaging Het
Prss53 G A 7: 127,488,802 (GRCm39) R31C probably damaging Het
Psmb8 T A 17: 34,417,435 (GRCm39) D21E probably benign Het
Ptprq A G 10: 107,478,813 (GRCm39) Y1277H probably damaging Het
Rexo2 T C 9: 48,380,176 (GRCm39) T219A probably benign Het
Rfc3 A G 5: 151,566,411 (GRCm39) F346S probably damaging Het
Rhoq A T 17: 87,304,373 (GRCm39) Q168L Het
Sgk1 A G 10: 21,874,096 (GRCm39) N452S probably damaging Het
Slc35f3 A G 8: 127,048,026 (GRCm39) K122R probably damaging Het
Slc4a2 T A 5: 24,644,761 (GRCm39) M1021K probably benign Het
Sorcs2 A G 5: 36,186,484 (GRCm39) V886A probably benign Het
Spata20 T A 11: 94,374,444 (GRCm39) M308L probably damaging Het
Spen A T 4: 141,199,098 (GRCm39) H3176Q probably benign Het
Stat5b T A 11: 100,692,361 (GRCm39) H141L probably benign Het
Syne2 T A 12: 75,995,839 (GRCm39) H2126Q possibly damaging Het
Traj46 A G 14: 54,409,851 (GRCm39) T20A Het
Trim30a G T 7: 104,078,330 (GRCm39) Q249K probably damaging Het
Trmt13 A G 3: 116,388,281 (GRCm39) Y52H probably benign Het
Trpv3 A G 11: 73,187,267 (GRCm39) I700V probably damaging Het
Tyr G A 7: 87,121,704 (GRCm39) H363Y probably damaging Het
Tyr C G 7: 87,121,705 (GRCm39) M362I possibly damaging Het
Ubb G A 11: 62,442,984 (GRCm39) V5M probably damaging Het
Unc5a T C 13: 55,150,288 (GRCm39) L519P probably damaging Het
Uso1 A G 5: 92,315,191 (GRCm39) D185G possibly damaging Het
Wdr49 A G 3: 75,240,669 (GRCm39) V400A probably damaging Het
Zfp292 A G 4: 34,810,794 (GRCm39) M755T probably benign Het
Other mutations in Vmn1r228
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Vmn1r228 APN 17 20,996,774 (GRCm39) missense probably benign 0.07
IGL03275:Vmn1r228 APN 17 20,997,104 (GRCm39) missense probably damaging 1.00
PIT4498001:Vmn1r228 UTSW 17 20,996,772 (GRCm39) missense probably benign 0.00
R0097:Vmn1r228 UTSW 17 20,996,625 (GRCm39) missense probably benign 0.05
R0097:Vmn1r228 UTSW 17 20,996,625 (GRCm39) missense probably benign 0.05
R0270:Vmn1r228 UTSW 17 20,996,858 (GRCm39) missense possibly damaging 0.60
R0279:Vmn1r228 UTSW 17 20,996,637 (GRCm39) missense probably benign 0.02
R1544:Vmn1r228 UTSW 17 20,997,285 (GRCm39) missense probably benign 0.00
R1695:Vmn1r228 UTSW 17 20,996,560 (GRCm39) missense possibly damaging 0.49
R2086:Vmn1r228 UTSW 17 20,997,455 (GRCm39) missense possibly damaging 0.71
R2275:Vmn1r228 UTSW 17 20,996,807 (GRCm39) missense probably damaging 1.00
R2965:Vmn1r228 UTSW 17 20,996,609 (GRCm39) missense probably damaging 0.99
R4425:Vmn1r228 UTSW 17 20,996,861 (GRCm39) missense probably damaging 1.00
R4447:Vmn1r228 UTSW 17 20,997,369 (GRCm39) missense probably damaging 0.96
R5031:Vmn1r228 UTSW 17 20,996,943 (GRCm39) nonsense probably null
R6345:Vmn1r228 UTSW 17 20,997,144 (GRCm39) missense probably damaging 1.00
R7064:Vmn1r228 UTSW 17 20,997,285 (GRCm39) missense probably benign 0.00
R7880:Vmn1r228 UTSW 17 20,996,672 (GRCm39) missense probably damaging 1.00
R8000:Vmn1r228 UTSW 17 20,997,227 (GRCm39) missense possibly damaging 0.88
R8290:Vmn1r228 UTSW 17 20,996,724 (GRCm39) missense probably benign 0.09
R9022:Vmn1r228 UTSW 17 20,996,778 (GRCm39) missense probably damaging 1.00
R9027:Vmn1r228 UTSW 17 20,997,422 (GRCm39) missense probably benign 0.01
R9291:Vmn1r228 UTSW 17 20,997,023 (GRCm39) missense probably benign
R9618:Vmn1r228 UTSW 17 20,997,045 (GRCm39) missense probably benign 0.00
X0018:Vmn1r228 UTSW 17 20,996,963 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CCAATTGGGATCATGTGAAAGAGC -3'
(R):5'- AAGTTTATGGGCCTGTCCATTTC -3'

Sequencing Primer
(F):5'- GGATCATGTGAAAGAGCAATATATCC -3'
(R):5'- GTCCATTTCCTTCTACTGGGTCATG -3'
Posted On 2022-07-18