Incidental Mutation 'R9493:1110017D15Rik'
ID 717052
Institutional Source Beutler Lab
Gene Symbol 1110017D15Rik
Ensembl Gene ENSMUSG00000028441
Gene Name RIKEN cDNA 1110017D15 gene
Synonyms Smrp1, Cbe1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9493 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 41505009-41517333 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 41508614 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 17 (P17L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030152] [ENSMUST00000095126]
AlphaFold Q2MH31
Predicted Effect possibly damaging
Transcript: ENSMUST00000030152
AA Change: P99L

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030152
Gene: ENSMUSG00000028441
AA Change: P99L

DomainStartEndE-ValueType
Pfam:SMRP1 1 260 3.3e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095126
AA Change: P99L

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000092744
Gene: ENSMUSG00000028441
AA Change: P99L

DomainStartEndE-ValueType
Pfam:SMRP1 1 202 6.5e-102 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000122537
Gene: ENSMUSG00000028441
AA Change: P17L

DomainStartEndE-ValueType
Pfam:SMRP1 1 176 5.2e-87 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear- or perinuclear-localized protein with no predicted domains or similarity to other known proteins. Expression of this gene is induced during the differentiation of bronchial epithelial cells, and the encoded protein may play a role in ciliogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,011,736 N53S Het
9930111J21Rik1 A G 11: 48,947,364 Y799H probably damaging Het
Akap5 G A 12: 76,328,267 A158T probably damaging Het
Aox4 A G 1: 58,247,275 K689E probably benign Het
Arid1b G A 17: 4,996,148 A404T unknown Het
Camk2b T A 11: 5,979,711 D396V probably damaging Het
Cd53 T A 3: 106,767,367 D128V probably null Het
Cdk15 G T 1: 59,287,784 R208L probably damaging Het
Celsr1 T G 15: 85,901,145 K2963Q probably damaging Het
Celsr2 A G 3: 108,393,758 S2740P probably damaging Het
Clca4b A T 3: 144,927,203 L162H probably damaging Het
Cntn1 A T 15: 92,291,763 T656S probably damaging Het
Creb3l1 C T 2: 91,991,886 probably null Het
Dpy19l2 A G 9: 24,619,163 Y507H probably damaging Het
Dsc3 A T 18: 19,989,695 C57* probably null Het
Dusp27 T A 1: 166,098,841 K1067N probably damaging Het
Gramd1b A G 9: 40,306,393 Y621H probably damaging Het
Ifi207 A T 1: 173,728,956 C739S probably benign Het
Il1rap T C 16: 26,722,952 S648P probably benign Het
Ints5 C T 19: 8,895,322 T215I probably damaging Het
Itm2c T C 1: 85,906,534 probably null Het
Lmo7 T A 14: 101,900,471 S870T probably benign Het
Lrpprc A T 17: 84,708,120 F1288I probably damaging Het
Megf11 A T 9: 64,640,094 H209L probably damaging Het
Mtss1 C T 15: 59,055,020 R69H probably damaging Het
Nms A T 1: 38,941,901 H56L probably benign Het
Olfr1102 T C 2: 87,002,796 S276P probably benign Het
Olfr1278 G A 2: 111,292,391 G41D probably damaging Het
Olfr1280 C T 2: 111,315,943 H155Y probably damaging Het
Olfr683 A T 7: 105,144,290 M7K possibly damaging Het
Pds5a G A 5: 65,635,404 R729W probably damaging Het
Pskh1 C T 8: 105,912,966 R93* probably null Het
Rapgef2 G A 3: 79,112,188 L59F probably damaging Het
Rtn4 G A 11: 29,741,011 V1101I probably damaging Het
Sec31b C A 19: 44,520,582 V653F probably damaging Het
Slc10a2 A G 8: 5,089,047 V299A Het
Slc6a15 A G 10: 103,393,416 I105M probably benign Het
Smurf1 A G 5: 144,896,585 V209A Het
Snapc2 A G 8: 4,254,591 E115G probably damaging Het
Sorcs2 T C 5: 36,042,185 E592G possibly damaging Het
Tcl1b1 A T 12: 105,164,564 Q102L probably damaging Het
Tmc1 T A 19: 20,824,280 N461Y probably benign Het
Trim59 C A 3: 69,037,801 G69C probably damaging Het
Tubg1 A G 11: 101,126,177 Y435C probably damaging Het
Ucp3 A C 7: 100,482,704 H254P probably benign Het
Vav2 T C 2: 27,267,264 D842G probably damaging Het
Vmn1r203 T A 13: 22,524,253 L68H probably damaging Het
Wee2 A G 6: 40,444,123 E49G probably benign Het
Zfr A G 15: 12,180,620 probably null Het
Other mutations in 1110017D15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:1110017D15Rik APN 4 41507178 missense probably damaging 1.00
IGL01062:1110017D15Rik APN 4 41511433 missense probably damaging 1.00
IGL02645:1110017D15Rik APN 4 41517080 missense probably damaging 1.00
IGL03124:1110017D15Rik APN 4 41507287 missense possibly damaging 0.87
R0284:1110017D15Rik UTSW 4 41507538 missense probably damaging 1.00
R1760:1110017D15Rik UTSW 4 41507330 critical splice acceptor site probably null
R1761:1110017D15Rik UTSW 4 41507223 missense probably damaging 1.00
R2073:1110017D15Rik UTSW 4 41507519 critical splice donor site probably null
R2180:1110017D15Rik UTSW 4 41507170 missense probably benign 0.00
R4414:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4415:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4416:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4417:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4516:1110017D15Rik UTSW 4 41517200 unclassified probably benign
R5132:1110017D15Rik UTSW 4 41517178 unclassified probably benign
R6132:1110017D15Rik UTSW 4 41517160 start codon destroyed probably null 0.98
R6413:1110017D15Rik UTSW 4 41505135 missense possibly damaging 0.86
R8519:1110017D15Rik UTSW 4 41505071 missense possibly damaging 0.93
R9594:1110017D15Rik UTSW 4 41505091 missense
Predicted Primers PCR Primer
(F):5'- GACCCTGCAGAATGGAGATG -3'
(R):5'- CACGTGTGGTAGATAGGGCATG -3'

Sequencing Primer
(F):5'- CCTGCAGAATGGAGATGGTGTG -3'
(R):5'- AGATAGGGCATGGTGCTTCC -3'
Posted On 2022-07-18