Incidental Mutation 'R9493:1110017D15Rik'
ID 717052
Institutional Source Beutler Lab
Gene Symbol 1110017D15Rik
Ensembl Gene ENSMUSG00000028441
Gene Name RIKEN cDNA 1110017D15 gene
Synonyms Smrp1, Cbe1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9493 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 41505009-41517333 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 41508614 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 17 (P17L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030152] [ENSMUST00000095126]
AlphaFold Q2MH31
Predicted Effect possibly damaging
Transcript: ENSMUST00000030152
AA Change: P99L

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030152
Gene: ENSMUSG00000028441
AA Change: P99L

DomainStartEndE-ValueType
Pfam:SMRP1 1 260 3.3e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095126
AA Change: P99L

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000092744
Gene: ENSMUSG00000028441
AA Change: P99L

DomainStartEndE-ValueType
Pfam:SMRP1 1 202 6.5e-102 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000122537
Gene: ENSMUSG00000028441
AA Change: P17L

DomainStartEndE-ValueType
Pfam:SMRP1 1 176 5.2e-87 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear- or perinuclear-localized protein with no predicted domains or similarity to other known proteins. Expression of this gene is induced during the differentiation of bronchial epithelial cells, and the encoded protein may play a role in ciliogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,011,736 (GRCm38) N53S Het
9930111J21Rik1 A G 11: 48,947,364 (GRCm38) Y799H probably damaging Het
Akap5 G A 12: 76,328,267 (GRCm38) A158T probably damaging Het
Aox4 A G 1: 58,247,275 (GRCm38) K689E probably benign Het
Arid1b G A 17: 4,996,148 (GRCm38) A404T unknown Het
Camk2b T A 11: 5,979,711 (GRCm38) D396V probably damaging Het
Cd53 T A 3: 106,767,367 (GRCm38) D128V probably null Het
Cdk15 G T 1: 59,287,784 (GRCm38) R208L probably damaging Het
Celsr1 T G 15: 85,901,145 (GRCm38) K2963Q probably damaging Het
Celsr2 A G 3: 108,393,758 (GRCm38) S2740P probably damaging Het
Clca4b A T 3: 144,927,203 (GRCm38) L162H probably damaging Het
Cntn1 A T 15: 92,291,763 (GRCm38) T656S probably damaging Het
Creb3l1 C T 2: 91,991,886 (GRCm38) probably null Het
Dpy19l2 A G 9: 24,619,163 (GRCm38) Y507H probably damaging Het
Dsc3 A T 18: 19,989,695 (GRCm38) C57* probably null Het
Dusp27 T A 1: 166,098,841 (GRCm38) K1067N probably damaging Het
Gramd1b A G 9: 40,306,393 (GRCm38) Y621H probably damaging Het
Ifi207 A T 1: 173,728,956 (GRCm38) C739S probably benign Het
Il1rap T C 16: 26,722,952 (GRCm38) S648P probably benign Het
Ints5 C T 19: 8,895,322 (GRCm38) T215I probably damaging Het
Itm2c T C 1: 85,906,534 (GRCm38) probably null Het
Lmo7 T A 14: 101,900,471 (GRCm38) S870T probably benign Het
Lrpprc A T 17: 84,708,120 (GRCm38) F1288I probably damaging Het
Megf11 A T 9: 64,640,094 (GRCm38) H209L probably damaging Het
Mtss1 C T 15: 59,055,020 (GRCm38) R69H probably damaging Het
Nms A T 1: 38,941,901 (GRCm38) H56L probably benign Het
Olfr1102 T C 2: 87,002,796 (GRCm38) S276P probably benign Het
Olfr1278 G A 2: 111,292,391 (GRCm38) G41D probably damaging Het
Olfr1280 C T 2: 111,315,943 (GRCm38) H155Y probably damaging Het
Olfr683 A T 7: 105,144,290 (GRCm38) M7K possibly damaging Het
Pds5a G A 5: 65,635,404 (GRCm38) R729W probably damaging Het
Pskh1 C T 8: 105,912,966 (GRCm38) R93* probably null Het
Rapgef2 G A 3: 79,112,188 (GRCm38) L59F probably damaging Het
Rtn4 G A 11: 29,741,011 (GRCm38) V1101I probably damaging Het
Sec31b C A 19: 44,520,582 (GRCm38) V653F probably damaging Het
Slc10a2 A G 8: 5,089,047 (GRCm38) V299A Het
Slc6a15 A G 10: 103,393,416 (GRCm38) I105M probably benign Het
Smurf1 A G 5: 144,896,585 (GRCm38) V209A Het
Snapc2 A G 8: 4,254,591 (GRCm38) E115G probably damaging Het
Sorcs2 T C 5: 36,042,185 (GRCm38) E592G possibly damaging Het
Tcl1b1 A T 12: 105,164,564 (GRCm38) Q102L probably damaging Het
Tmc1 T A 19: 20,824,280 (GRCm38) N461Y probably benign Het
Trim59 C A 3: 69,037,801 (GRCm38) G69C probably damaging Het
Tubg1 A G 11: 101,126,177 (GRCm38) Y435C probably damaging Het
Ucp3 A C 7: 100,482,704 (GRCm38) H254P probably benign Het
Vav2 T C 2: 27,267,264 (GRCm38) D842G probably damaging Het
Vmn1r203 T A 13: 22,524,253 (GRCm38) L68H probably damaging Het
Wee2 A G 6: 40,444,123 (GRCm38) E49G probably benign Het
Zfr A G 15: 12,180,620 (GRCm38) probably null Het
Other mutations in 1110017D15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:1110017D15Rik APN 4 41,507,178 (GRCm38) missense probably damaging 1.00
IGL01062:1110017D15Rik APN 4 41,511,433 (GRCm38) missense probably damaging 1.00
IGL02645:1110017D15Rik APN 4 41,517,080 (GRCm38) missense probably damaging 1.00
IGL03124:1110017D15Rik APN 4 41,507,287 (GRCm38) missense possibly damaging 0.87
R0284:1110017D15Rik UTSW 4 41,507,538 (GRCm38) missense probably damaging 1.00
R1760:1110017D15Rik UTSW 4 41,507,330 (GRCm38) critical splice acceptor site probably null
R1761:1110017D15Rik UTSW 4 41,507,223 (GRCm38) missense probably damaging 1.00
R2073:1110017D15Rik UTSW 4 41,507,519 (GRCm38) critical splice donor site probably null
R2180:1110017D15Rik UTSW 4 41,507,170 (GRCm38) missense probably benign 0.00
R4414:1110017D15Rik UTSW 4 41,505,574 (GRCm38) missense possibly damaging 0.71
R4415:1110017D15Rik UTSW 4 41,505,574 (GRCm38) missense possibly damaging 0.71
R4416:1110017D15Rik UTSW 4 41,505,574 (GRCm38) missense possibly damaging 0.71
R4417:1110017D15Rik UTSW 4 41,505,574 (GRCm38) missense possibly damaging 0.71
R4516:1110017D15Rik UTSW 4 41,517,200 (GRCm38) unclassified probably benign
R5132:1110017D15Rik UTSW 4 41,517,178 (GRCm38) unclassified probably benign
R6132:1110017D15Rik UTSW 4 41,517,160 (GRCm38) start codon destroyed probably null 0.98
R6413:1110017D15Rik UTSW 4 41,505,135 (GRCm38) missense possibly damaging 0.86
R8519:1110017D15Rik UTSW 4 41,505,071 (GRCm38) missense possibly damaging 0.93
R9594:1110017D15Rik UTSW 4 41,505,091 (GRCm38) missense
Predicted Primers PCR Primer
(F):5'- GACCCTGCAGAATGGAGATG -3'
(R):5'- CACGTGTGGTAGATAGGGCATG -3'

Sequencing Primer
(F):5'- CCTGCAGAATGGAGATGGTGTG -3'
(R):5'- AGATAGGGCATGGTGCTTCC -3'
Posted On 2022-07-18