Incidental Mutation 'R9493:Sorcs2'
ID 717053
Institutional Source Beutler Lab
Gene Symbol Sorcs2
Ensembl Gene ENSMUSG00000029093
Gene Name sortilin-related VPS10 domain containing receptor 2
Synonyms VPS10 domain receptor protein
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9493 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 36174524-36555483 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36199529 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 592 (E592G)
Ref Sequence ENSEMBL: ENSMUSP00000041828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037370]
AlphaFold Q9EPR5
Predicted Effect possibly damaging
Transcript: ENSMUST00000037370
AA Change: E592G

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093
AA Change: E592G

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
VPS10 170 780 N/A SMART
PKD 782 872 7.27e-2 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced dopamine levels and dopamine metabolism, dopaminergic hyperinnervation of the frontal cortex, hyperactivity, abnormal behavioral response to amphetamine, and decreased induction of Schwann cell apoptosis following sciatic nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,838,191 (GRCm39) Y799H probably damaging Het
Akap5 G A 12: 76,375,041 (GRCm39) A158T probably damaging Het
Aox4 A G 1: 58,286,434 (GRCm39) K689E probably benign Het
Arid1b G A 17: 5,046,423 (GRCm39) A404T unknown Het
Bltp1 A G 3: 37,065,885 (GRCm39) N53S Het
Camk2b T A 11: 5,929,711 (GRCm39) D396V probably damaging Het
Cd53 T A 3: 106,674,683 (GRCm39) D128V probably null Het
Cdk15 G T 1: 59,326,943 (GRCm39) R208L probably damaging Het
Celsr1 T G 15: 85,785,346 (GRCm39) K2963Q probably damaging Het
Celsr2 A G 3: 108,301,074 (GRCm39) S2740P probably damaging Het
Clca4b A T 3: 144,632,964 (GRCm39) L162H probably damaging Het
Cntn1 A T 15: 92,189,644 (GRCm39) T656S probably damaging Het
Creb3l1 C T 2: 91,822,231 (GRCm39) probably null Het
Dpy19l2 A G 9: 24,530,459 (GRCm39) Y507H probably damaging Het
Dsc3 A T 18: 20,122,752 (GRCm39) C57* probably null Het
Gramd1b A G 9: 40,217,689 (GRCm39) Y621H probably damaging Het
Ifi207 A T 1: 173,556,522 (GRCm39) C739S probably benign Het
Il1rap T C 16: 26,541,702 (GRCm39) S648P probably benign Het
Ints5 C T 19: 8,872,686 (GRCm39) T215I probably damaging Het
Itm2c T C 1: 85,834,255 (GRCm39) probably null Het
Lmo7 T A 14: 102,137,907 (GRCm39) S870T probably benign Het
Lrpprc A T 17: 85,015,548 (GRCm39) F1288I probably damaging Het
Megf11 A T 9: 64,547,376 (GRCm39) H209L probably damaging Het
Mtss1 C T 15: 58,926,869 (GRCm39) R69H probably damaging Het
Nms A T 1: 38,980,982 (GRCm39) H56L probably benign Het
Or4f54 G A 2: 111,122,736 (GRCm39) G41D probably damaging Het
Or4k36 C T 2: 111,146,288 (GRCm39) H155Y probably damaging Het
Or56a5 A T 7: 104,793,497 (GRCm39) M7K possibly damaging Het
Or5t17 T C 2: 86,833,140 (GRCm39) S276P probably benign Het
Pds5a G A 5: 65,792,747 (GRCm39) R729W probably damaging Het
Pskh1 C T 8: 106,639,598 (GRCm39) R93* probably null Het
Rapgef2 G A 3: 79,019,495 (GRCm39) L59F probably damaging Het
Rtn4 G A 11: 29,691,011 (GRCm39) V1101I probably damaging Het
Sec31b C A 19: 44,509,021 (GRCm39) V653F probably damaging Het
Slc10a2 A G 8: 5,139,047 (GRCm39) V299A Het
Slc6a15 A G 10: 103,229,277 (GRCm39) I105M probably benign Het
Smurf1 A G 5: 144,833,395 (GRCm39) V209A Het
Snapc2 A G 8: 4,304,591 (GRCm39) E115G probably damaging Het
Spmip6 G A 4: 41,508,614 (GRCm39) P17L Het
Styxl2 T A 1: 165,926,410 (GRCm39) K1067N probably damaging Het
Tcl1b1 A T 12: 105,130,823 (GRCm39) Q102L probably damaging Het
Tmc1 T A 19: 20,801,644 (GRCm39) N461Y probably benign Het
Trim59 C A 3: 68,945,134 (GRCm39) G69C probably damaging Het
Tubg1 A G 11: 101,017,003 (GRCm39) Y435C probably damaging Het
Ucp3 A C 7: 100,131,911 (GRCm39) H254P probably benign Het
Vav2 T C 2: 27,157,276 (GRCm39) D842G probably damaging Het
Vmn1r203 T A 13: 22,708,423 (GRCm39) L68H probably damaging Het
Wee2 A G 6: 40,421,057 (GRCm39) E49G probably benign Het
Zfr A G 15: 12,180,706 (GRCm39) probably null Het
Other mutations in Sorcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Sorcs2 APN 5 36,194,745 (GRCm39) splice site probably null
IGL01064:Sorcs2 APN 5 36,222,696 (GRCm39) missense probably damaging 1.00
IGL01120:Sorcs2 APN 5 36,178,596 (GRCm39) missense probably damaging 0.99
IGL01730:Sorcs2 APN 5 36,205,153 (GRCm39) missense probably damaging 1.00
IGL02542:Sorcs2 APN 5 36,183,286 (GRCm39) missense probably damaging 0.98
IGL02730:Sorcs2 APN 5 36,219,896 (GRCm39) missense probably benign 0.11
IGL02965:Sorcs2 APN 5 36,235,301 (GRCm39) missense probably benign 0.13
IGL02997:Sorcs2 APN 5 36,225,492 (GRCm39) missense probably damaging 1.00
IGL03000:Sorcs2 APN 5 36,222,675 (GRCm39) unclassified probably benign
IGL03141:Sorcs2 APN 5 36,222,699 (GRCm39) missense probably benign 0.01
IGL03184:Sorcs2 APN 5 36,188,556 (GRCm39) missense probably benign 0.01
IGL03412:Sorcs2 APN 5 36,203,848 (GRCm39) missense probably damaging 1.00
R0180:Sorcs2 UTSW 5 36,311,189 (GRCm39) missense probably damaging 1.00
R0244:Sorcs2 UTSW 5 36,554,897 (GRCm39) splice site probably benign
R0345:Sorcs2 UTSW 5 36,185,218 (GRCm39) missense probably benign 0.01
R0519:Sorcs2 UTSW 5 36,188,534 (GRCm39) missense probably benign 0.08
R0624:Sorcs2 UTSW 5 36,222,777 (GRCm39) missense probably damaging 0.97
R0625:Sorcs2 UTSW 5 36,181,916 (GRCm39) missense possibly damaging 0.65
R1169:Sorcs2 UTSW 5 36,185,269 (GRCm39) missense possibly damaging 0.70
R1721:Sorcs2 UTSW 5 36,184,092 (GRCm39) missense probably damaging 0.98
R1809:Sorcs2 UTSW 5 36,386,564 (GRCm39) splice site probably benign
R1935:Sorcs2 UTSW 5 36,228,731 (GRCm39) missense possibly damaging 0.88
R1936:Sorcs2 UTSW 5 36,228,731 (GRCm39) missense possibly damaging 0.88
R2279:Sorcs2 UTSW 5 36,199,430 (GRCm39) splice site probably null
R3148:Sorcs2 UTSW 5 36,193,132 (GRCm39) missense probably benign 0.09
R3803:Sorcs2 UTSW 5 36,555,150 (GRCm39) missense probably benign 0.36
R3863:Sorcs2 UTSW 5 36,555,007 (GRCm39) nonsense probably null
R4092:Sorcs2 UTSW 5 36,183,166 (GRCm39) missense possibly damaging 0.92
R4620:Sorcs2 UTSW 5 36,194,838 (GRCm39) missense probably benign 0.00
R5079:Sorcs2 UTSW 5 36,200,796 (GRCm39) missense probably damaging 1.00
R5301:Sorcs2 UTSW 5 36,196,734 (GRCm39) missense probably damaging 1.00
R5470:Sorcs2 UTSW 5 36,188,527 (GRCm39) missense probably benign 0.00
R5568:Sorcs2 UTSW 5 36,203,874 (GRCm39) nonsense probably null
R5727:Sorcs2 UTSW 5 36,188,630 (GRCm39) missense possibly damaging 0.52
R5874:Sorcs2 UTSW 5 36,386,555 (GRCm39) missense probably damaging 1.00
R5890:Sorcs2 UTSW 5 36,386,535 (GRCm39) missense probably damaging 1.00
R5946:Sorcs2 UTSW 5 36,186,427 (GRCm39) missense probably damaging 1.00
R6005:Sorcs2 UTSW 5 36,176,728 (GRCm39) missense probably damaging 1.00
R6048:Sorcs2 UTSW 5 36,185,332 (GRCm39) splice site probably null
R6290:Sorcs2 UTSW 5 36,219,931 (GRCm39) missense probably damaging 1.00
R6292:Sorcs2 UTSW 5 36,219,931 (GRCm39) missense probably damaging 1.00
R6617:Sorcs2 UTSW 5 36,235,310 (GRCm39) missense probably damaging 1.00
R6681:Sorcs2 UTSW 5 36,555,154 (GRCm39) missense probably benign 0.00
R7024:Sorcs2 UTSW 5 36,178,605 (GRCm39) missense probably damaging 0.99
R7056:Sorcs2 UTSW 5 36,225,474 (GRCm39) missense probably damaging 1.00
R7569:Sorcs2 UTSW 5 36,183,220 (GRCm39) missense probably benign 0.01
R7641:Sorcs2 UTSW 5 36,555,296 (GRCm39) missense probably damaging 0.99
R7651:Sorcs2 UTSW 5 36,185,322 (GRCm39) missense probably damaging 1.00
R7674:Sorcs2 UTSW 5 36,555,296 (GRCm39) missense probably damaging 0.99
R7722:Sorcs2 UTSW 5 36,200,871 (GRCm39) missense probably damaging 1.00
R7748:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R7764:Sorcs2 UTSW 5 36,181,416 (GRCm39) missense possibly damaging 0.48
R7813:Sorcs2 UTSW 5 36,181,958 (GRCm39) missense probably damaging 1.00
R8142:Sorcs2 UTSW 5 36,219,958 (GRCm39) missense possibly damaging 0.67
R8246:Sorcs2 UTSW 5 36,219,932 (GRCm39) missense probably damaging 1.00
R8254:Sorcs2 UTSW 5 36,195,550 (GRCm39) missense probably benign 0.00
R8349:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R8350:Sorcs2 UTSW 5 36,311,207 (GRCm39) missense probably damaging 0.96
R8354:Sorcs2 UTSW 5 36,222,753 (GRCm39) missense probably benign 0.01
R8449:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R8679:Sorcs2 UTSW 5 36,196,657 (GRCm39) missense probably benign 0.09
R8771:Sorcs2 UTSW 5 36,188,624 (GRCm39) missense probably damaging 1.00
R8935:Sorcs2 UTSW 5 36,193,202 (GRCm39) missense possibly damaging 0.79
R8964:Sorcs2 UTSW 5 36,386,511 (GRCm39) missense possibly damaging 0.85
R9164:Sorcs2 UTSW 5 36,235,312 (GRCm39) missense possibly damaging 0.94
R9221:Sorcs2 UTSW 5 36,181,910 (GRCm39) critical splice donor site probably null
R9290:Sorcs2 UTSW 5 36,183,225 (GRCm39) missense probably damaging 0.96
R9358:Sorcs2 UTSW 5 36,200,814 (GRCm39) missense probably damaging 1.00
R9492:Sorcs2 UTSW 5 36,186,484 (GRCm39) missense probably benign 0.08
R9640:Sorcs2 UTSW 5 36,222,765 (GRCm39) nonsense probably null
RF063:Sorcs2 UTSW 5 36,311,155 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACTGGCCTAGTAGCAGGAAG -3'
(R):5'- CTGATTAGTCAAGGATGCCATGTGG -3'

Sequencing Primer
(F):5'- AGGCCCAGTATGAGGTCAC -3'
(R):5'- CTGGCAGGTGGTCTTACCG -3'
Posted On 2022-07-18