Incidental Mutation 'R9493:Slc6a15'
ID 717065
Institutional Source Beutler Lab
Gene Symbol Slc6a15
Ensembl Gene ENSMUSG00000019894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms v7-3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9493 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 103203644-103255238 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103229277 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 105 (I105M)
Ref Sequence ENSEMBL: ENSMUSP00000073829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636] [ENSMUST00000217905]
AlphaFold Q8BG16
Predicted Effect probably benign
Transcript: ENSMUST00000074204
AA Change: I105M

PolyPhen 2 Score 0.352 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: I105M

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179636
AA Change: I105M

PolyPhen 2 Score 0.352 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: I105M

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217905
AA Change: I105M

PolyPhen 2 Score 0.352 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,838,191 (GRCm39) Y799H probably damaging Het
Akap5 G A 12: 76,375,041 (GRCm39) A158T probably damaging Het
Aox4 A G 1: 58,286,434 (GRCm39) K689E probably benign Het
Arid1b G A 17: 5,046,423 (GRCm39) A404T unknown Het
Bltp1 A G 3: 37,065,885 (GRCm39) N53S Het
Camk2b T A 11: 5,929,711 (GRCm39) D396V probably damaging Het
Cd53 T A 3: 106,674,683 (GRCm39) D128V probably null Het
Cdk15 G T 1: 59,326,943 (GRCm39) R208L probably damaging Het
Celsr1 T G 15: 85,785,346 (GRCm39) K2963Q probably damaging Het
Celsr2 A G 3: 108,301,074 (GRCm39) S2740P probably damaging Het
Clca4b A T 3: 144,632,964 (GRCm39) L162H probably damaging Het
Cntn1 A T 15: 92,189,644 (GRCm39) T656S probably damaging Het
Creb3l1 C T 2: 91,822,231 (GRCm39) probably null Het
Dpy19l2 A G 9: 24,530,459 (GRCm39) Y507H probably damaging Het
Dsc3 A T 18: 20,122,752 (GRCm39) C57* probably null Het
Gramd1b A G 9: 40,217,689 (GRCm39) Y621H probably damaging Het
Ifi207 A T 1: 173,556,522 (GRCm39) C739S probably benign Het
Il1rap T C 16: 26,541,702 (GRCm39) S648P probably benign Het
Ints5 C T 19: 8,872,686 (GRCm39) T215I probably damaging Het
Itm2c T C 1: 85,834,255 (GRCm39) probably null Het
Lmo7 T A 14: 102,137,907 (GRCm39) S870T probably benign Het
Lrpprc A T 17: 85,015,548 (GRCm39) F1288I probably damaging Het
Megf11 A T 9: 64,547,376 (GRCm39) H209L probably damaging Het
Mtss1 C T 15: 58,926,869 (GRCm39) R69H probably damaging Het
Nms A T 1: 38,980,982 (GRCm39) H56L probably benign Het
Or4f54 G A 2: 111,122,736 (GRCm39) G41D probably damaging Het
Or4k36 C T 2: 111,146,288 (GRCm39) H155Y probably damaging Het
Or56a5 A T 7: 104,793,497 (GRCm39) M7K possibly damaging Het
Or5t17 T C 2: 86,833,140 (GRCm39) S276P probably benign Het
Pds5a G A 5: 65,792,747 (GRCm39) R729W probably damaging Het
Pskh1 C T 8: 106,639,598 (GRCm39) R93* probably null Het
Rapgef2 G A 3: 79,019,495 (GRCm39) L59F probably damaging Het
Rtn4 G A 11: 29,691,011 (GRCm39) V1101I probably damaging Het
Sec31b C A 19: 44,509,021 (GRCm39) V653F probably damaging Het
Slc10a2 A G 8: 5,139,047 (GRCm39) V299A Het
Smurf1 A G 5: 144,833,395 (GRCm39) V209A Het
Snapc2 A G 8: 4,304,591 (GRCm39) E115G probably damaging Het
Sorcs2 T C 5: 36,199,529 (GRCm39) E592G possibly damaging Het
Spmip6 G A 4: 41,508,614 (GRCm39) P17L Het
Styxl2 T A 1: 165,926,410 (GRCm39) K1067N probably damaging Het
Tcl1b1 A T 12: 105,130,823 (GRCm39) Q102L probably damaging Het
Tmc1 T A 19: 20,801,644 (GRCm39) N461Y probably benign Het
Trim59 C A 3: 68,945,134 (GRCm39) G69C probably damaging Het
Tubg1 A G 11: 101,017,003 (GRCm39) Y435C probably damaging Het
Ucp3 A C 7: 100,131,911 (GRCm39) H254P probably benign Het
Vav2 T C 2: 27,157,276 (GRCm39) D842G probably damaging Het
Vmn1r203 T A 13: 22,708,423 (GRCm39) L68H probably damaging Het
Wee2 A G 6: 40,421,057 (GRCm39) E49G probably benign Het
Zfr A G 15: 12,180,706 (GRCm39) probably null Het
Other mutations in Slc6a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Slc6a15 APN 10 103,225,002 (GRCm39) missense probably benign
IGL01320:Slc6a15 APN 10 103,240,606 (GRCm39) missense probably benign 0.00
IGL01924:Slc6a15 APN 10 103,240,686 (GRCm39) splice site probably null
IGL02066:Slc6a15 APN 10 103,252,519 (GRCm39) missense probably damaging 0.98
IGL02164:Slc6a15 APN 10 103,254,083 (GRCm39) missense probably benign 0.01
IGL02551:Slc6a15 APN 10 103,240,136 (GRCm39) splice site probably benign
IGL02744:Slc6a15 APN 10 103,253,894 (GRCm39) missense probably benign 0.03
R0028:Slc6a15 UTSW 10 103,252,541 (GRCm39) missense probably benign 0.00
R0143:Slc6a15 UTSW 10 103,253,929 (GRCm39) missense probably benign 0.02
R0158:Slc6a15 UTSW 10 103,225,208 (GRCm39) splice site probably benign
R0165:Slc6a15 UTSW 10 103,245,670 (GRCm39) missense probably null 0.04
R0349:Slc6a15 UTSW 10 103,254,086 (GRCm39) missense probably benign 0.06
R0383:Slc6a15 UTSW 10 103,253,914 (GRCm39) missense probably damaging 1.00
R0614:Slc6a15 UTSW 10 103,240,213 (GRCm39) nonsense probably null
R0784:Slc6a15 UTSW 10 103,252,661 (GRCm39) splice site probably benign
R0944:Slc6a15 UTSW 10 103,245,657 (GRCm39) missense probably benign 0.01
R1795:Slc6a15 UTSW 10 103,236,121 (GRCm39) missense probably benign
R1882:Slc6a15 UTSW 10 103,230,925 (GRCm39) missense probably benign 0.20
R2061:Slc6a15 UTSW 10 103,245,595 (GRCm39) missense probably benign 0.20
R2156:Slc6a15 UTSW 10 103,229,269 (GRCm39) missense probably damaging 1.00
R2358:Slc6a15 UTSW 10 103,252,646 (GRCm39) missense probably benign 0.00
R2849:Slc6a15 UTSW 10 103,240,552 (GRCm39) missense probably benign 0.01
R2921:Slc6a15 UTSW 10 103,254,248 (GRCm39) missense probably damaging 0.99
R3709:Slc6a15 UTSW 10 103,229,275 (GRCm39) missense probably benign 0.00
R4532:Slc6a15 UTSW 10 103,245,648 (GRCm39) missense possibly damaging 0.69
R4825:Slc6a15 UTSW 10 103,253,921 (GRCm39) missense probably benign 0.05
R4909:Slc6a15 UTSW 10 103,240,275 (GRCm39) missense probably damaging 1.00
R5112:Slc6a15 UTSW 10 103,225,087 (GRCm39) missense probably benign
R5320:Slc6a15 UTSW 10 103,244,067 (GRCm39) missense probably damaging 1.00
R5364:Slc6a15 UTSW 10 103,229,369 (GRCm39) missense probably damaging 0.99
R6305:Slc6a15 UTSW 10 103,225,031 (GRCm39) missense probably benign 0.31
R6348:Slc6a15 UTSW 10 103,240,228 (GRCm39) missense probably damaging 1.00
R6729:Slc6a15 UTSW 10 103,229,775 (GRCm39) missense probably damaging 0.99
R6781:Slc6a15 UTSW 10 103,230,928 (GRCm39) missense probably damaging 0.99
R7409:Slc6a15 UTSW 10 103,244,163 (GRCm39) missense probably benign
R7549:Slc6a15 UTSW 10 103,224,998 (GRCm39) missense probably benign
R7660:Slc6a15 UTSW 10 103,229,241 (GRCm39) splice site probably null
R7839:Slc6a15 UTSW 10 103,240,660 (GRCm39) missense probably benign
R7948:Slc6a15 UTSW 10 103,240,156 (GRCm39) missense possibly damaging 0.95
R8278:Slc6a15 UTSW 10 103,229,890 (GRCm39) critical splice donor site probably null
R8379:Slc6a15 UTSW 10 103,225,048 (GRCm39) missense probably benign 0.00
R8685:Slc6a15 UTSW 10 103,245,556 (GRCm39) missense possibly damaging 0.68
R8712:Slc6a15 UTSW 10 103,225,112 (GRCm39) missense probably damaging 1.00
R8719:Slc6a15 UTSW 10 103,240,176 (GRCm39) missense probably damaging 0.99
R8832:Slc6a15 UTSW 10 103,225,179 (GRCm39) missense probably damaging 1.00
R8940:Slc6a15 UTSW 10 103,229,357 (GRCm39) missense probably damaging 1.00
R8978:Slc6a15 UTSW 10 103,230,953 (GRCm39) nonsense probably null
R9050:Slc6a15 UTSW 10 103,252,516 (GRCm39) missense possibly damaging 0.88
R9113:Slc6a15 UTSW 10 103,236,140 (GRCm39) missense probably damaging 1.00
R9242:Slc6a15 UTSW 10 103,229,406 (GRCm39) nonsense probably null
R9529:Slc6a15 UTSW 10 103,240,583 (GRCm39) missense probably benign 0.14
R9532:Slc6a15 UTSW 10 103,240,333 (GRCm39) missense probably damaging 0.98
RF013:Slc6a15 UTSW 10 103,236,077 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTCCTAGAGCAGTCTAATACAGG -3'
(R):5'- CCCGGGTAAGAGCAAATGTC -3'

Sequencing Primer
(F):5'- GAGCAGTCTAATACAGGATTCAAAG -3'
(R):5'- GTCATGGAAAGAAACTTACTACACAG -3'
Posted On 2022-07-18