Mutagenetix > Incidental Mutation

Incidental Mutation 'R9493:Slc6a15'

717065

Institutional Source

Beutler Lab

Gene Symbol

Slc6a15

Ensembl Gene

ENSMUSG00000019894

Gene Name

solute carrier family 6 (neurotransmitter transporter), member 15

Synonyms

v7-3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9493 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

103367783-103419377 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 103393416 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 105 (I105M)

Ref Sequence

ENSEMBL: ENSMUSP00000073829 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636] [ENSMUST00000217905]

AlphaFold

Q8BG16

Predicted Effect

probably benign
Transcript: ENSMUST00000074204
AA Change: I105M

PolyPhen 2 Score 0.352 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: I105M

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:SNF	61	644	2.2e-229	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000179636
AA Change: I105M

PolyPhen 2 Score 0.352 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: I105M

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:SNF	61	644	2.2e-229	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000217905
AA Change: I105M

PolyPhen 2 Score 0.352 (Sensitivity: 0.90; Specificity: 0.89)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	G	A	4: 41,508,614	P17L		Het
4932438A13Rik	A	G	3: 37,011,736	N53S		Het
9930111J21Rik1	A	G	11: 48,947,364	Y799H	probably damaging	Het
Akap5	G	A	12: 76,328,267	A158T	probably damaging	Het
Aox4	A	G	1: 58,247,275	K689E	probably benign	Het
Arid1b	G	A	17: 4,996,148	A404T	unknown	Het
Camk2b	T	A	11: 5,979,711	D396V	probably damaging	Het
Cd53	T	A	3: 106,767,367	D128V	probably null	Het
Cdk15	G	T	1: 59,287,784	R208L	probably damaging	Het
Celsr1	T	G	15: 85,901,145	K2963Q	probably damaging	Het
Celsr2	A	G	3: 108,393,758	S2740P	probably damaging	Het
Clca4b	A	T	3: 144,927,203	L162H	probably damaging	Het
Cntn1	A	T	15: 92,291,763	T656S	probably damaging	Het
Creb3l1	C	T	2: 91,991,886		probably null	Het
Dpy19l2	A	G	9: 24,619,163	Y507H	probably damaging	Het
Dsc3	A	T	18: 19,989,695	C57*	probably null	Het
Dusp27	T	A	1: 166,098,841	K1067N	probably damaging	Het
Gramd1b	A	G	9: 40,306,393	Y621H	probably damaging	Het
Ifi207	A	T	1: 173,728,956	C739S	probably benign	Het
Il1rap	T	C	16: 26,722,952	S648P	probably benign	Het
Ints5	C	T	19: 8,895,322	T215I	probably damaging	Het
Itm2c	T	C	1: 85,906,534		probably null	Het
Lmo7	T	A	14: 101,900,471	S870T	probably benign	Het
Lrpprc	A	T	17: 84,708,120	F1288I	probably damaging	Het
Megf11	A	T	9: 64,640,094	H209L	probably damaging	Het
Mtss1	C	T	15: 59,055,020	R69H	probably damaging	Het
Nms	A	T	1: 38,941,901	H56L	probably benign	Het
Olfr1102	T	C	2: 87,002,796	S276P	probably benign	Het
Olfr1278	G	A	2: 111,292,391	G41D	probably damaging	Het
Olfr1280	C	T	2: 111,315,943	H155Y	probably damaging	Het
Olfr683	A	T	7: 105,144,290	M7K	possibly damaging	Het
Pds5a	G	A	5: 65,635,404	R729W	probably damaging	Het
Pskh1	C	T	8: 105,912,966	R93*	probably null	Het
Rapgef2	G	A	3: 79,112,188	L59F	probably damaging	Het
Rtn4	G	A	11: 29,741,011	V1101I	probably damaging	Het
Sec31b	C	A	19: 44,520,582	V653F	probably damaging	Het
Slc10a2	A	G	8: 5,089,047	V299A		Het
Smurf1	A	G	5: 144,896,585	V209A		Het
Snapc2	A	G	8: 4,254,591	E115G	probably damaging	Het
Sorcs2	T	C	5: 36,042,185	E592G	possibly damaging	Het
Tcl1b1	A	T	12: 105,164,564	Q102L	probably damaging	Het
Tmc1	T	A	19: 20,824,280	N461Y	probably benign	Het
Trim59	C	A	3: 69,037,801	G69C	probably damaging	Het
Tubg1	A	G	11: 101,126,177	Y435C	probably damaging	Het
Ucp3	A	C	7: 100,482,704	H254P	probably benign	Het
Vav2	T	C	2: 27,267,264	D842G	probably damaging	Het
Vmn1r203	T	A	13: 22,524,253	L68H	probably damaging	Het
Wee2	A	G	6: 40,444,123	E49G	probably benign	Het
Zfr	A	G	15: 12,180,620		probably null	Het

Other mutations in Slc6a15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Slc6a15	APN	10	103389141	missense	probably benign
IGL01320:Slc6a15	APN	10	103404745	missense	probably benign	0.00
IGL01924:Slc6a15	APN	10	103404825	splice site	probably null
IGL02066:Slc6a15	APN	10	103416658	missense	probably damaging	0.98
IGL02164:Slc6a15	APN	10	103418222	missense	probably benign	0.01
IGL02551:Slc6a15	APN	10	103404275	splice site	probably benign
IGL02744:Slc6a15	APN	10	103418033	missense	probably benign	0.03
R0028:Slc6a15	UTSW	10	103416680	missense	probably benign	0.00
R0143:Slc6a15	UTSW	10	103418068	missense	probably benign	0.02
R0158:Slc6a15	UTSW	10	103389347	splice site	probably benign
R0165:Slc6a15	UTSW	10	103409809	missense	probably null	0.04
R0349:Slc6a15	UTSW	10	103418225	missense	probably benign	0.06
R0383:Slc6a15	UTSW	10	103418053	missense	probably damaging	1.00
R0614:Slc6a15	UTSW	10	103404352	nonsense	probably null
R0784:Slc6a15	UTSW	10	103416800	splice site	probably benign
R0944:Slc6a15	UTSW	10	103409796	missense	probably benign	0.01
R1795:Slc6a15	UTSW	10	103400260	missense	probably benign
R1882:Slc6a15	UTSW	10	103395064	missense	probably benign	0.20
R2061:Slc6a15	UTSW	10	103409734	missense	probably benign	0.20
R2156:Slc6a15	UTSW	10	103393408	missense	probably damaging	1.00
R2358:Slc6a15	UTSW	10	103416785	missense	probably benign	0.00
R2849:Slc6a15	UTSW	10	103404691	missense	probably benign	0.01
R2921:Slc6a15	UTSW	10	103418387	missense	probably damaging	0.99
R3709:Slc6a15	UTSW	10	103393414	missense	probably benign	0.00
R4532:Slc6a15	UTSW	10	103409787	missense	possibly damaging	0.69
R4825:Slc6a15	UTSW	10	103418060	missense	probably benign	0.05
R4909:Slc6a15	UTSW	10	103404414	missense	probably damaging	1.00
R5112:Slc6a15	UTSW	10	103389226	missense	probably benign
R5320:Slc6a15	UTSW	10	103408206	missense	probably damaging	1.00
R5364:Slc6a15	UTSW	10	103393508	missense	probably damaging	0.99
R6305:Slc6a15	UTSW	10	103389170	missense	probably benign	0.31
R6348:Slc6a15	UTSW	10	103404367	missense	probably damaging	1.00
R6729:Slc6a15	UTSW	10	103393914	missense	probably damaging	0.99
R6781:Slc6a15	UTSW	10	103395067	missense	probably damaging	0.99
R7409:Slc6a15	UTSW	10	103408302	missense	probably benign
R7549:Slc6a15	UTSW	10	103389137	missense	probably benign
R7660:Slc6a15	UTSW	10	103393380	splice site	probably null
R7839:Slc6a15	UTSW	10	103404799	missense	probably benign
R7948:Slc6a15	UTSW	10	103404295	missense	possibly damaging	0.95
R8278:Slc6a15	UTSW	10	103394029	critical splice donor site	probably null
R8379:Slc6a15	UTSW	10	103389187	missense	probably benign	0.00
R8685:Slc6a15	UTSW	10	103409695	missense	possibly damaging	0.68
R8712:Slc6a15	UTSW	10	103389251	missense	probably damaging	1.00
R8719:Slc6a15	UTSW	10	103404315	missense	probably damaging	0.99
R8832:Slc6a15	UTSW	10	103389318	missense	probably damaging	1.00
R8940:Slc6a15	UTSW	10	103393496	missense	probably damaging	1.00
R8978:Slc6a15	UTSW	10	103395092	nonsense	probably null
R9050:Slc6a15	UTSW	10	103416655	missense	possibly damaging	0.88
R9113:Slc6a15	UTSW	10	103400279	missense	probably damaging	1.00
R9242:Slc6a15	UTSW	10	103393545	nonsense	probably null
R9529:Slc6a15	UTSW	10	103404722	missense	probably benign	0.14
R9532:Slc6a15	UTSW	10	103404472	missense	probably damaging	0.98
RF013:Slc6a15	UTSW	10	103400216	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACTTCCTAGAGCAGTCTAATACAGG -3'
(R):5'- CCCGGGTAAGAGCAAATGTC -3'

Sequencing Primer
(F):5'- GAGCAGTCTAATACAGGATTCAAAG -3'
(R):5'- GTCATGGAAAGAAACTTACTACACAG -3'

Posted On

2022-07-18