Incidental Mutation 'R9494:Als2'
ID 717085
Institutional Source Beutler Lab
Gene Symbol Als2
Ensembl Gene ENSMUSG00000026024
Gene Name alsin Rho guanine nucleotide exchange factor
Synonyms 3222402C23Rik, Als2cr6, 9430073A21Rik, Alsin
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.672) question?
Stock # R9494 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 59162926-59237231 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 59167505 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1593 (D1593G)
Ref Sequence ENSEMBL: ENSMUSP00000027178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027178] [ENSMUST00000114275] [ENSMUST00000163058]
AlphaFold Q920R0
Predicted Effect probably damaging
Transcript: ENSMUST00000027178
AA Change: D1593G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027178
Gene: ENSMUSG00000026024
AA Change: D1593G

DomainStartEndE-ValueType
Pfam:RCC1_2 93 122 1.1e-9 PFAM
Pfam:RCC1 109 165 9.5e-11 PFAM
Pfam:RCC1 170 216 6.6e-11 PFAM
low complexity region 268 282 N/A INTRINSIC
low complexity region 465 483 N/A INTRINSIC
Pfam:RCC1 521 568 5.4e-13 PFAM
Pfam:RCC1_2 555 584 8.3e-12 PFAM
Pfam:RCC1 571 619 3.4e-11 PFAM
Pfam:RhoGEF 688 877 6.5e-10 PFAM
PH 895 1001 2.17e0 SMART
MORN 1041 1062 1.34e-5 SMART
MORN 1064 1085 1.95e-1 SMART
MORN 1092 1113 6.68e-6 SMART
MORN 1115 1136 9.39e0 SMART
MORN 1143 1164 1.49e1 SMART
MORN 1167 1188 1.13e1 SMART
MORN 1190 1211 2.28e0 SMART
MORN 1213 1235 5.95e1 SMART
low complexity region 1470 1483 N/A INTRINSIC
Pfam:VPS9 1546 1650 8.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114275
SMART Domains Protein: ENSMUSP00000109914
Gene: ENSMUSG00000079550

DomainStartEndE-ValueType
L27 46 101 4.02e-9 SMART
L27 105 158 2.49e-14 SMART
PDZ 180 253 3.57e-11 SMART
SH3 263 329 2.94e-5 SMART
low complexity region 367 381 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
GuKc 444 637 1.21e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163058
AA Change: D1593G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125753
Gene: ENSMUSG00000026024
AA Change: D1593G

DomainStartEndE-ValueType
Pfam:RCC1_2 93 122 9.9e-10 PFAM
Pfam:RCC1 109 165 9.5e-12 PFAM
Pfam:RCC1 170 216 4.9e-12 PFAM
low complexity region 268 282 N/A INTRINSIC
low complexity region 465 483 N/A INTRINSIC
Pfam:RCC1 521 568 4.6e-14 PFAM
Pfam:RCC1_2 555 584 1.2e-11 PFAM
Pfam:RCC1 571 619 8.6e-11 PFAM
Pfam:RhoGEF 688 877 2.6e-10 PFAM
PH 895 1001 2.17e0 SMART
MORN 1041 1062 1.34e-5 SMART
MORN 1064 1085 1.95e-1 SMART
MORN 1092 1113 6.68e-6 SMART
MORN 1115 1136 9.39e0 SMART
MORN 1143 1164 1.49e1 SMART
MORN 1167 1188 1.13e1 SMART
MORN 1190 1211 2.28e0 SMART
MORN 1213 1235 5.95e1 SMART
low complexity region 1470 1483 N/A INTRINSIC
Pfam:VPS9 1546 1650 1e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an ATS1/RCC1-like domain, a RhoGEF domain, and a vacuolar protein sorting 9 (VPS9) domain, all of which are guanine-nucleotide exchange factors that activate members of the Ras superfamily of GTPases. The protein functions as a guanine nucleotide exchange factor for the small GTPase RAB5. The protein localizes with RAB5 on early endosomal compartments, and functions as a modulator for endosomal dynamics. Mutations in this gene result in several forms of juvenile lateral sclerosis and infantile-onset ascending spastic paralysis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mutations in this gene may result in increased body weight, altered endosome trafficking, modest motor behavioral abnormalities, altered anxiety responses, impaired axonal transport, and mild neurolopathogical deficits including axonal degeneration in the corticospinal tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad2b C A 12: 5,031,852 P1254T probably benign Het
Brsk2 C T 7: 142,002,218 R716C possibly damaging Het
Bzw2 T A 12: 36,134,948 M1L probably benign Het
Cd300ld2 T A 11: 115,010,423 H277L possibly damaging Het
Col6a5 A T 9: 105,945,533 D208E unknown Het
Cul3 T A 1: 80,277,452 S544C probably damaging Het
Enpp1 C A 10: 24,651,336 R651L probably benign Het
Epha10 C T 4: 124,914,856 A766V Het
Epor A G 9: 21,959,226 Y453H probably damaging Het
Fam13a T C 6: 58,953,523 K468R probably benign Het
Fam160a1 A T 3: 85,676,258 Y410* probably null Het
Ffar4 C T 19: 38,097,635 A170V probably benign Het
Gm10203 A G 6: 149,130,242 Y15C unknown Het
Kansl1 T C 11: 104,356,740 T595A probably benign Het
Lmtk2 A T 5: 144,100,520 probably benign Het
Mybl2 G A 2: 163,075,923 V69I possibly damaging Het
Myo1d T C 11: 80,484,267 K994E probably benign Het
Olfr501-ps1 C A 7: 108,508,593 T179K unknown Het
Pcdhga10 A T 18: 37,749,368 R727S probably benign Het
Pgp T A 17: 24,470,835 L109Q probably damaging Het
Piwil2 C T 14: 70,422,972 G68D probably benign Het
Pms2 T A 5: 143,916,396 I193N probably damaging Het
Pnpla7 T A 2: 25,052,378 L1236* probably null Het
Pole2 A G 12: 69,202,957 V489A possibly damaging Het
Rapgef2 G A 3: 79,112,188 L59F probably damaging Het
Rnf32 T C 5: 29,224,147 S241P probably damaging Het
Samd9l T A 6: 3,375,830 K477I possibly damaging Het
Stn1 C T 19: 47,524,686 probably null Het
Svep1 A G 4: 58,070,577 V2403A possibly damaging Het
Synrg T C 11: 83,990,921 M361T probably benign Het
Tbc1d2b A T 9: 90,270,510 Y68N probably damaging Het
Tbc1d4 A T 14: 101,608,459 M1K probably null Het
Thsd1 C T 8: 22,243,252 P105L probably benign Het
Tnxb T C 17: 34,685,822 L1187P probably damaging Het
Trio T C 15: 27,846,757 T1057A probably benign Het
Tubg1 T C 11: 101,120,898 I77T probably damaging Het
Txndc11 A G 16: 11,134,292 L73P probably damaging Het
Uck1 G A 2: 32,258,167 R182* probably null Het
Vangl1 T C 3: 102,163,349 S424G probably damaging Het
Vmn2r69 G A 7: 85,411,560 S272L probably damaging Het
Vmn2r69 A G 7: 85,406,876 W685R probably benign Het
Zbtb18 A T 1: 177,448,082 D327V probably benign Het
Zfp607b T C 7: 27,703,667 F516S probably damaging Het
Zzz3 A G 3: 152,427,831 I175M possibly damaging Het
Other mutations in Als2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Als2 APN 1 59169896 nonsense probably null
IGL00924:Als2 APN 1 59215862 missense probably benign 0.03
IGL00949:Als2 APN 1 59215572 missense probably damaging 1.00
IGL00950:Als2 APN 1 59215382 missense probably benign 0.01
IGL01090:Als2 APN 1 59215616 missense possibly damaging 0.81
IGL01116:Als2 APN 1 59186004 splice site probably benign
IGL02001:Als2 APN 1 59180188 splice site probably benign
IGL02075:Als2 APN 1 59207786 missense probably damaging 1.00
IGL02441:Als2 APN 1 59215472 missense probably damaging 0.98
IGL02728:Als2 APN 1 59196347 missense probably benign 0.00
IGL02740:Als2 APN 1 59169919 missense probably benign 0.01
IGL02885:Als2 APN 1 59167491 missense probably benign 0.30
IGL02896:Als2 APN 1 59183787 missense probably benign 0.17
IGL02978:Als2 APN 1 59215165 missense probably benign 0.32
IGL03032:Als2 APN 1 59216030 splice site probably benign
IGL03065:Als2 APN 1 59215872 missense probably benign
IGL03212:Als2 APN 1 59202926 missense probably benign 0.00
IGL03226:Als2 APN 1 59186520 missense probably benign 0.43
R0014:Als2 UTSW 1 59211388 missense possibly damaging 0.53
R0243:Als2 UTSW 1 59215387 missense probably benign
R0326:Als2 UTSW 1 59180583 missense probably damaging 1.00
R0376:Als2 UTSW 1 59215565 missense probably benign 0.00
R0605:Als2 UTSW 1 59168414 missense probably benign 0.02
R1607:Als2 UTSW 1 59180147 missense probably damaging 1.00
R1631:Als2 UTSW 1 59218067 missense probably benign 0.00
R1657:Als2 UTSW 1 59180601 missense probably damaging 1.00
R1763:Als2 UTSW 1 59174991 missense probably benign
R1950:Als2 UTSW 1 59185601 critical splice acceptor site probably null
R1970:Als2 UTSW 1 59215169 missense probably benign 0.34
R2151:Als2 UTSW 1 59207789 missense probably damaging 1.00
R2292:Als2 UTSW 1 59187385 missense probably damaging 1.00
R2513:Als2 UTSW 1 59215117 missense probably benign 0.00
R2849:Als2 UTSW 1 59206538 missense probably damaging 0.97
R2869:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2869:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2870:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2870:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2872:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2872:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2873:Als2 UTSW 1 59211137 missense probably damaging 1.00
R3054:Als2 UTSW 1 59215494 missense probably damaging 1.00
R3081:Als2 UTSW 1 59187349 missense probably damaging 1.00
R3176:Als2 UTSW 1 59170008 missense possibly damaging 0.88
R3276:Als2 UTSW 1 59170008 missense possibly damaging 0.88
R3801:Als2 UTSW 1 59167199 missense probably damaging 1.00
R3803:Als2 UTSW 1 59167199 missense probably damaging 1.00
R3808:Als2 UTSW 1 59170450 missense probably benign 0.08
R3884:Als2 UTSW 1 59185568 missense probably damaging 0.99
R4012:Als2 UTSW 1 59187416 missense probably benign 0.09
R4033:Als2 UTSW 1 59196241 missense probably benign
R4201:Als2 UTSW 1 59180154 missense possibly damaging 0.77
R4321:Als2 UTSW 1 59167454 splice site probably benign
R4707:Als2 UTSW 1 59215313 missense probably benign
R4784:Als2 UTSW 1 59215313 missense probably benign
R4785:Als2 UTSW 1 59215313 missense probably benign
R4991:Als2 UTSW 1 59207768 missense probably benign 0.10
R5068:Als2 UTSW 1 59211274 missense probably benign 0.13
R5110:Als2 UTSW 1 59185441 missense probably damaging 0.98
R5141:Als2 UTSW 1 59170452 missense possibly damaging 0.80
R5394:Als2 UTSW 1 59174946 missense probably benign 0.06
R5621:Als2 UTSW 1 59191890 missense probably benign 0.33
R5685:Als2 UTSW 1 59179091 missense possibly damaging 0.73
R5987:Als2 UTSW 1 59206587 missense probably damaging 1.00
R6012:Als2 UTSW 1 59185215 missense probably damaging 1.00
R6118:Als2 UTSW 1 59203069 missense possibly damaging 0.62
R6222:Als2 UTSW 1 59180125 missense probably benign 0.04
R6367:Als2 UTSW 1 59199140 missense probably benign 0.04
R6394:Als2 UTSW 1 59167197 missense probably damaging 0.99
R6866:Als2 UTSW 1 59211133 missense probably damaging 1.00
R6965:Als2 UTSW 1 59170557 missense possibly damaging 0.70
R7038:Als2 UTSW 1 59167514 missense possibly damaging 0.94
R7178:Als2 UTSW 1 59207812 missense probably damaging 0.96
R7494:Als2 UTSW 1 59183166 splice site probably null
R7541:Als2 UTSW 1 59167616 splice site probably null
R7601:Als2 UTSW 1 59170002 missense probably benign 0.17
R8380:Als2 UTSW 1 59211308 missense probably benign
R8478:Als2 UTSW 1 59186016 missense probably damaging 0.96
R8492:Als2 UTSW 1 59211344 missense probably damaging 0.98
R9048:Als2 UTSW 1 59186511 missense possibly damaging 0.81
R9090:Als2 UTSW 1 59203030 missense probably benign 0.01
R9128:Als2 UTSW 1 59180550 missense probably benign 0.00
R9206:Als2 UTSW 1 59185247 missense probably damaging 1.00
R9271:Als2 UTSW 1 59203030 missense probably benign 0.01
R9430:Als2 UTSW 1 59192039 missense probably benign 0.00
R9455:Als2 UTSW 1 59180137 missense probably damaging 1.00
R9482:Als2 UTSW 1 59191950 missense probably damaging 1.00
R9544:Als2 UTSW 1 59211309 missense probably benign 0.00
R9796:Als2 UTSW 1 59170442 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATGCTGTCTCTAAGTGGCCC -3'
(R):5'- AATTGAGGCATGTGACCTGG -3'

Sequencing Primer
(F):5'- CTCCTTTAGAATCAACTGATGACGC -3'
(R):5'- CATTTACTCCATCAGACAAGC -3'
Posted On 2022-07-18