Incidental Mutation 'R9494:Pole2'
ID 717120
Institutional Source Beutler Lab
Gene Symbol Pole2
Ensembl Gene ENSMUSG00000020974
Gene Name polymerase (DNA directed), epsilon 2 (p59 subunit)
Synonyms DNA polymerase epsilon small subunit
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9494 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 69248547-69274969 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 69249731 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 489 (V489A)
Ref Sequence ENSEMBL: ENSMUSP00000152262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021356] [ENSMUST00000021359] [ENSMUST00000221411] [ENSMUST00000222699]
AlphaFold O54956
Predicted Effect probably benign
Transcript: ENSMUST00000021356
SMART Domains Protein: ENSMUSP00000021356
Gene: ENSMUSG00000020973

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
Pfam:PIH1 43 352 2e-99 PFAM
low complexity region 360 373 N/A INTRINSIC
SCOP:d1keka4 398 460 4e-3 SMART
low complexity region 672 693 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000021359
SMART Domains Protein: ENSMUSP00000021359
Gene: ENSMUSG00000020974

DomainStartEndE-ValueType
Pfam:Dpoe2NT 2 74 1.9e-32 PFAM
Pfam:DNA_pol_E_B 287 489 1.4e-58 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000221411
AA Change: V489A

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect silent
Transcript: ENSMUST00000222699
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA polymerase epsilon, which is involved in DNA repair and replication, is composed of a large catalytic subunit and a small accessory subunit. The protein encoded by this gene represents the small subunit (B). Defects in this gene have been linked to colorectal cancer and to combined immunodeficiency. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2 T C 1: 59,206,664 (GRCm39) D1593G probably damaging Het
Atad2b C A 12: 5,081,852 (GRCm39) P1254T probably benign Het
Brsk2 C T 7: 141,555,955 (GRCm39) R716C possibly damaging Het
Bzw2 T A 12: 36,184,947 (GRCm39) M1L probably benign Het
Cd300ld2 T A 11: 114,901,249 (GRCm39) H277L possibly damaging Het
Col6a5 A T 9: 105,822,732 (GRCm39) D208E unknown Het
Cul3 T A 1: 80,255,169 (GRCm39) S544C probably damaging Het
Enpp1 C A 10: 24,527,234 (GRCm39) R651L probably benign Het
Epha10 C T 4: 124,808,649 (GRCm39) A766V Het
Epor A G 9: 21,870,522 (GRCm39) Y453H probably damaging Het
Fam13a T C 6: 58,930,508 (GRCm39) K468R probably benign Het
Ffar4 C T 19: 38,086,083 (GRCm39) A170V probably benign Het
Fhip1a A T 3: 85,583,565 (GRCm39) Y410* probably null Het
Gm10203 A G 6: 149,031,740 (GRCm39) Y15C unknown Het
Kansl1 T C 11: 104,247,566 (GRCm39) T595A probably benign Het
Lmtk2 A T 5: 144,037,338 (GRCm39) probably benign Het
Mybl2 G A 2: 162,917,843 (GRCm39) V69I possibly damaging Het
Myo1d T C 11: 80,375,093 (GRCm39) K994E probably benign Het
Or5p75-ps1 C A 7: 108,107,800 (GRCm39) T179K unknown Het
Pcdhga10 A T 18: 37,882,421 (GRCm39) R727S probably benign Het
Pgp T A 17: 24,689,809 (GRCm39) L109Q probably damaging Het
Piwil2 C T 14: 70,660,421 (GRCm39) G68D probably benign Het
Pms2 T A 5: 143,853,214 (GRCm39) I193N probably damaging Het
Pnpla7 T A 2: 24,942,390 (GRCm39) L1236* probably null Het
Rapgef2 G A 3: 79,019,495 (GRCm39) L59F probably damaging Het
Rnf32 T C 5: 29,429,145 (GRCm39) S241P probably damaging Het
Samd9l T A 6: 3,375,830 (GRCm39) K477I possibly damaging Het
Stn1 C T 19: 47,513,125 (GRCm39) probably null Het
Svep1 A G 4: 58,070,577 (GRCm39) V2403A possibly damaging Het
Synrg T C 11: 83,881,747 (GRCm39) M361T probably benign Het
Tbc1d2b A T 9: 90,152,563 (GRCm39) Y68N probably damaging Het
Tbc1d4 A T 14: 101,845,895 (GRCm39) M1K probably null Het
Thsd1 C T 8: 22,733,268 (GRCm39) P105L probably benign Het
Tnxb T C 17: 34,904,796 (GRCm39) L1187P probably damaging Het
Trio T C 15: 27,846,843 (GRCm39) T1057A probably benign Het
Tubg1 T C 11: 101,011,724 (GRCm39) I77T probably damaging Het
Txndc11 A G 16: 10,952,156 (GRCm39) L73P probably damaging Het
Uck1 G A 2: 32,148,179 (GRCm39) R182* probably null Het
Vangl1 T C 3: 102,070,665 (GRCm39) S424G probably damaging Het
Vmn2r69 A G 7: 85,056,084 (GRCm39) W685R probably benign Het
Vmn2r69 G A 7: 85,060,768 (GRCm39) S272L probably damaging Het
Zbtb18 A T 1: 177,275,648 (GRCm39) D327V probably benign Het
Zfp607b T C 7: 27,403,092 (GRCm39) F516S probably damaging Het
Zzz3 A G 3: 152,133,468 (GRCm39) I175M possibly damaging Het
Other mutations in Pole2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Pole2 APN 12 69,273,219 (GRCm39) splice site probably benign
IGL00940:Pole2 APN 12 69,262,134 (GRCm39) missense probably damaging 1.00
IGL01593:Pole2 APN 12 69,269,873 (GRCm39) splice site probably null
IGL01609:Pole2 APN 12 69,254,631 (GRCm39) critical splice donor site probably null
IGL01717:Pole2 APN 12 69,260,623 (GRCm39) missense probably damaging 1.00
IGL02168:Pole2 APN 12 69,248,660 (GRCm39) unclassified probably benign
IGL02208:Pole2 APN 12 69,269,936 (GRCm39) missense possibly damaging 0.91
IGL02966:Pole2 APN 12 69,256,649 (GRCm39) missense probably damaging 1.00
PIT4504001:Pole2 UTSW 12 69,256,759 (GRCm39) nonsense probably null
R0069:Pole2 UTSW 12 69,256,661 (GRCm39) missense probably damaging 1.00
R0069:Pole2 UTSW 12 69,256,661 (GRCm39) missense probably damaging 1.00
R0396:Pole2 UTSW 12 69,269,160 (GRCm39) splice site probably benign
R0574:Pole2 UTSW 12 69,258,231 (GRCm39) splice site probably benign
R0620:Pole2 UTSW 12 69,256,653 (GRCm39) missense probably damaging 1.00
R0685:Pole2 UTSW 12 69,258,187 (GRCm39) missense probably damaging 0.98
R0791:Pole2 UTSW 12 69,254,703 (GRCm39) missense probably benign 0.06
R1452:Pole2 UTSW 12 69,254,703 (GRCm39) missense probably benign 0.06
R1453:Pole2 UTSW 12 69,254,703 (GRCm39) missense probably benign 0.06
R1455:Pole2 UTSW 12 69,254,703 (GRCm39) missense probably benign 0.06
R1912:Pole2 UTSW 12 69,256,764 (GRCm39) missense probably damaging 0.99
R2067:Pole2 UTSW 12 69,274,926 (GRCm39) missense probably benign 0.01
R2929:Pole2 UTSW 12 69,256,712 (GRCm39) missense probably benign 0.13
R3016:Pole2 UTSW 12 69,268,836 (GRCm39) missense probably benign 0.14
R4504:Pole2 UTSW 12 69,269,242 (GRCm39) missense probably benign 0.00
R4765:Pole2 UTSW 12 69,268,826 (GRCm39) missense possibly damaging 0.49
R4790:Pole2 UTSW 12 69,273,139 (GRCm39) missense probably benign 0.00
R4896:Pole2 UTSW 12 69,269,924 (GRCm39) missense probably damaging 0.97
R6998:Pole2 UTSW 12 69,260,680 (GRCm39) missense possibly damaging 0.82
R7257:Pole2 UTSW 12 69,249,684 (GRCm39) missense probably damaging 1.00
R7535:Pole2 UTSW 12 69,269,203 (GRCm39) missense probably benign 0.10
R7841:Pole2 UTSW 12 69,251,032 (GRCm39) missense probably damaging 1.00
R8437:Pole2 UTSW 12 69,250,961 (GRCm39) nonsense probably null
R8506:Pole2 UTSW 12 69,255,734 (GRCm39) missense probably benign
R9467:Pole2 UTSW 12 69,255,719 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GCATTCCCAGTAAGCCAATGC -3'
(R):5'- AGGAAACGTGATTCTGCATGAC -3'

Sequencing Primer
(F):5'- GTAAGCCAATGCAGACATACAAG -3'
(R):5'- TGATCTACAGAGCTAGTTCCAAG -3'
Posted On 2022-07-18