Incidental Mutation 'R9495:Tor1aip1'
ID 717132
Institutional Source Beutler Lab
Gene Symbol Tor1aip1
Ensembl Gene ENSMUSG00000026466
Gene Name torsin A interacting protein 1
Synonyms LAP1
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9495 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 155880345-155912226 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 155906177 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 205 (D205V)
Ref Sequence ENSEMBL: ENSMUSP00000095134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027738] [ENSMUST00000097527] [ENSMUST00000111757] [ENSMUST00000130995] [ENSMUST00000136331] [ENSMUST00000136397] [ENSMUST00000141878] [ENSMUST00000169241]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000027738
AA Change: D205V

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000027738
Gene: ENSMUSG00000026466
AA Change: D205V

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
Pfam:LAP1C 122 265 9.1e-36 PFAM
Pfam:LAP1C 257 520 6.7e-171 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097527
AA Change: D205V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095134
Gene: ENSMUSG00000026466
AA Change: D205V

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
low complexity region 149 167 N/A INTRINSIC
Pfam:LAP1C 244 576 1.9e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111757
SMART Domains Protein: ENSMUSP00000107387
Gene: ENSMUSG00000050565

DomainStartEndE-ValueType
Pfam:LAP1C 26 501 3.9e-169 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123705
SMART Domains Protein: ENSMUSP00000120602
Gene: ENSMUSG00000026466

DomainStartEndE-ValueType
Pfam:LAP1C 1 59 4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130995
AA Change: D205V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141619
Gene: ENSMUSG00000026466
AA Change: D205V

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
Pfam:LAP1C 122 273 3.8e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136331
AA Change: D205V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137617
Gene: ENSMUSG00000026466
AA Change: D205V

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
Pfam:LAP1C 122 283 8.4e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136397
AA Change: D20V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118654
Gene: ENSMUSG00000026466
AA Change: D20V

DomainStartEndE-ValueType
Pfam:LAP1C 1 77 5.6e-15 PFAM
Pfam:LAP1C 74 190 5.7e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141878
AA Change: D20V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123391
Gene: ENSMUSG00000026466
AA Change: D20V

DomainStartEndE-ValueType
Pfam:LAP1C 1 176 1.4e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169241
AA Change: D20V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126751
Gene: ENSMUSG00000026466
AA Change: D20V

DomainStartEndE-ValueType
Pfam:LAP1C 1 77 1.6e-14 PFAM
Pfam:LAP1C 75 391 2.4e-195 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 2 integral membrane protein that binds A- and B-type lamins. The encoded protein localizes to the inner nuclear membrane and may be involved in maintaining the attachment of the nuclear membrane to the nuclear lamina during cell division. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit perinatal lethality and nuclear membrane blebs in neural and nonneural tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T A 15: 79,019,842 (GRCm39) D158V probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
Aadacl2fm1 T C 3: 59,840,114 (GRCm39) I62T possibly damaging Het
Acp5 G A 9: 22,038,483 (GRCm39) Q273* probably null Het
Apoa5 G C 9: 46,181,944 (GRCm39) R340P probably damaging Het
Atp2b1 T A 10: 98,835,660 (GRCm39) N468K probably damaging Het
Bltp3a A G 17: 28,112,414 (GRCm39) D1201G probably damaging Het
Bphl A T 13: 34,234,312 (GRCm39) I143L probably benign Het
Cd33 A T 7: 43,182,150 (GRCm39) H98Q probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Cemip2 T A 19: 21,779,249 (GRCm39) V353D probably damaging Het
Cfap96 C T 8: 46,409,458 (GRCm39) S287N probably damaging Het
Colec10 A G 15: 54,325,761 (GRCm39) D197G probably damaging Het
Cpt1a T C 19: 3,433,795 (GRCm39) M759T probably benign Het
Ctc1 A G 11: 68,913,593 (GRCm39) Y165C probably damaging Het
Cyp2t4 G A 7: 26,854,717 (GRCm39) V66M possibly damaging Het
Dnah2 T C 11: 69,345,208 (GRCm39) D2667G possibly damaging Het
Dok1 T C 6: 83,009,972 (GRCm39) K46E probably damaging Het
Erv3 C A 2: 131,697,975 (GRCm39) W128L possibly damaging Het
Fam186a A G 15: 99,844,766 (GRCm39) S493P unknown Het
Fbn1 A T 2: 125,160,984 (GRCm39) N2185K probably damaging Het
Figla A C 6: 85,997,689 (GRCm39) H139P probably benign Het
Gemin4 A G 11: 76,101,749 (GRCm39) L1004P probably damaging Het
Gm11937 T C 11: 99,500,646 (GRCm39) T124A unknown Het
Gm17669 G T 18: 67,695,682 (GRCm39) V76L probably benign Het
H2ac21 A G 3: 96,127,401 (GRCm39) E57G probably damaging Het
Hcls1 A T 16: 36,777,702 (GRCm39) M274L probably benign Het
Il17rc T C 6: 113,449,741 (GRCm39) S116P probably damaging Het
Krt79 G A 15: 101,840,288 (GRCm39) R303C probably damaging Het
Lamb2 C T 9: 108,358,006 (GRCm39) T149I probably damaging Het
Lrrc41 T A 4: 115,932,806 (GRCm39) probably null Het
Mga C A 2: 119,781,676 (GRCm39) T2234K possibly damaging Het
Mix23 A G 16: 35,892,491 (GRCm39) E12G probably benign Het
Muc6 T A 7: 141,237,398 (GRCm39) Q205L probably damaging Het
Nlrp9b A T 7: 19,760,462 (GRCm39) K624N possibly damaging Het
Or1o4 G T 17: 37,591,386 (GRCm39) probably benign Het
Or4d2 C T 11: 87,784,082 (GRCm39) V223M probably benign Het
Or6e1 T C 14: 54,520,137 (GRCm39) T72A probably damaging Het
Otud4 T C 8: 80,400,087 (GRCm39) S934P probably damaging Het
Pcdha12 G T 18: 37,155,526 (GRCm39) W748C probably damaging Het
Pdc T C 1: 150,208,919 (GRCm39) I134T probably damaging Het
Peg10 T TCCC 6: 4,756,451 (GRCm39) probably benign Het
Pkn1 C T 8: 84,410,799 (GRCm39) R276Q possibly damaging Het
Plin3 C A 17: 56,587,824 (GRCm39) G297V probably benign Het
Podn C T 4: 107,876,106 (GRCm39) V517I probably benign Het
Pomk T C 8: 26,473,344 (GRCm39) D203G probably damaging Het
Ppil4 A G 10: 7,675,355 (GRCm39) D168G probably damaging Het
Ptgr2 T C 12: 84,354,647 (GRCm39) I276T probably benign Het
Ptk7 T A 17: 46,887,744 (GRCm39) I563F possibly damaging Het
Rbm12 G T 2: 155,939,738 (GRCm39) T178K unknown Het
Sctr T C 1: 119,959,403 (GRCm39) probably null Het
Sh2b1 GGGACC GGGACCGGCTCAGCCACGTGGACC 7: 126,066,744 (GRCm39) probably benign Het
Spata31e4 T A 13: 50,855,465 (GRCm39) S368T possibly damaging Het
Steap1 A T 5: 5,786,458 (GRCm39) D326E probably damaging Het
Stra6 G A 9: 58,059,175 (GRCm39) V513I probably benign Het
Tbx19 A G 1: 164,966,546 (GRCm39) S443P unknown Het
Tcea3 T A 4: 135,991,885 (GRCm39) C190S probably damaging Het
Tfr2 G A 5: 137,572,701 (GRCm39) V171I probably benign Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tmem129 A G 5: 33,815,122 (GRCm39) V17A probably benign Het
Tmem87b T C 2: 128,660,353 (GRCm39) L32P probably damaging Het
Trim33 T C 3: 103,239,074 (GRCm39) V684A probably benign Het
Triobp C T 15: 78,877,378 (GRCm39) R1637C probably damaging Het
Ulbp1 C A 10: 7,406,371 (GRCm39) M196I probably benign Het
Vash1 G A 12: 86,738,663 (GRCm39) G370E probably damaging Het
Vmn2r23 A G 6: 123,689,672 (GRCm39) T183A probably benign Het
Vta1 A G 10: 14,531,583 (GRCm39) I264T probably benign Het
Zcchc8 A T 5: 123,838,633 (GRCm39) M635K probably benign Het
Other mutations in Tor1aip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Tor1aip1 APN 1 155,907,213 (GRCm39) missense probably benign 0.01
IGL00837:Tor1aip1 APN 1 155,882,662 (GRCm39) utr 3 prime probably benign
IGL02573:Tor1aip1 APN 1 155,889,117 (GRCm39) missense probably damaging 0.99
IGL02815:Tor1aip1 APN 1 155,911,662 (GRCm39) missense probably damaging 1.00
IGL02964:Tor1aip1 APN 1 155,911,590 (GRCm39) missense probably damaging 0.96
IGL03128:Tor1aip1 APN 1 155,882,781 (GRCm39) missense probably damaging 1.00
R0100:Tor1aip1 UTSW 1 155,882,821 (GRCm39) missense probably damaging 1.00
R0319:Tor1aip1 UTSW 1 155,882,927 (GRCm39) missense probably damaging 1.00
R0410:Tor1aip1 UTSW 1 155,911,686 (GRCm39) missense possibly damaging 0.85
R0458:Tor1aip1 UTSW 1 155,906,153 (GRCm39) missense probably damaging 0.99
R0506:Tor1aip1 UTSW 1 155,883,420 (GRCm39) nonsense probably null
R0563:Tor1aip1 UTSW 1 155,911,554 (GRCm39) missense probably damaging 1.00
R1696:Tor1aip1 UTSW 1 155,893,262 (GRCm39) missense possibly damaging 0.67
R1745:Tor1aip1 UTSW 1 155,906,180 (GRCm39) splice site probably null
R1830:Tor1aip1 UTSW 1 155,883,308 (GRCm39) missense probably damaging 1.00
R2132:Tor1aip1 UTSW 1 155,883,308 (GRCm39) missense probably damaging 1.00
R4487:Tor1aip1 UTSW 1 155,882,870 (GRCm39) missense probably damaging 1.00
R5613:Tor1aip1 UTSW 1 155,909,499 (GRCm39) missense probably damaging 0.98
R5657:Tor1aip1 UTSW 1 155,883,234 (GRCm39) missense probably damaging 1.00
R6123:Tor1aip1 UTSW 1 155,882,951 (GRCm39) missense probably damaging 1.00
R6380:Tor1aip1 UTSW 1 155,894,234 (GRCm39) missense possibly damaging 0.85
R6647:Tor1aip1 UTSW 1 155,893,999 (GRCm39) missense possibly damaging 0.94
R6852:Tor1aip1 UTSW 1 155,911,566 (GRCm39) missense probably damaging 0.99
R7354:Tor1aip1 UTSW 1 155,911,859 (GRCm39) missense probably damaging 0.98
R7463:Tor1aip1 UTSW 1 155,883,355 (GRCm39) missense possibly damaging 0.48
R7615:Tor1aip1 UTSW 1 155,883,330 (GRCm39) missense possibly damaging 0.93
R8859:Tor1aip1 UTSW 1 155,907,190 (GRCm39) missense probably benign 0.04
R8956:Tor1aip1 UTSW 1 155,909,582 (GRCm39) intron probably benign
R9514:Tor1aip1 UTSW 1 155,906,177 (GRCm39) missense probably damaging 1.00
R9628:Tor1aip1 UTSW 1 155,893,320 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTACAAAGCTGACACCAGTG -3'
(R):5'- TGAGCTGCTCTGTACAGTCG -3'

Sequencing Primer
(F):5'- TGTCAGGCCACGGTTCAATC -3'
(R):5'- AGCATGTGCTAAGGAGCT -3'
Posted On 2022-07-18