Mutagenetix > Incidental Mutation

Incidental Mutation 'R9495:Tbx19'

717133

Institutional Source

Beutler Lab

Gene Symbol

Tbx19

Ensembl Gene

ENSMUSG00000026572

Gene Name

T-box 19

Synonyms

Tpit, D1Ertd754e

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.797) question?

Stock #

R9495 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

165137855-165160773 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 165138977 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 443 (S443P)

Ref Sequence

ENSEMBL: ENSMUSP00000027859 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027859]

AlphaFold

Q99ME7

Predicted Effect

unknown
Transcript: ENSMUST00000027859
AA Change: S443P

SMART Domains

Protein: ENSMUSP00000027859
Gene: ENSMUSG00000026572
AA Change: S443P

Domain	Start	End	E-Value	Type
TBOX	38	221	1.26e-114	SMART
low complexity region	263	275	N/A	INTRINSIC
Blast:TBOX	343	410	2e-18	BLAST
low complexity region	424	443	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000161144
AA Change: S314P

SMART Domains

Protein: ENSMUSP00000123909
Gene: ENSMUSG00000026572
AA Change: S314P

Domain	Start	End	E-Value	Type
TBOX	1	156	4.56e-80	SMART
Blast:TBOX	215	282	5e-19	BLAST
low complexity region	296	315	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of a family of transcription factors containing a characteristic T-box DNA-binding domain. The encoded protein promotes expression of the pro-opiomelanocortin (POMC) gene, which is important for the differentiation of cells in the pituitary gland. [provided by RefSeq, Mar 2013]
PHENOTYPE: The phenotype of homozygous null mice is similar to that of patients with early onset pituitary ACTH deficiency. They are characterized by fasting-induced hypoglycemia due to an impaired pituitary-adrenal axis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029J07Rik	C	T	8: 45,956,421	S287N	probably damaging	Het
1700088E04Rik	T	A	15: 79,135,642	D158V	probably benign	Het
2200002D01Rik	CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	7: 29,247,623		probably benign	Het
Acp5	G	A	9: 22,127,187	Q273*	probably null	Het
Apoa5	G	C	9: 46,270,646	R340P	probably damaging	Het
Atp2b1	T	A	10: 98,999,798	N468K	probably damaging	Het
Bphl	A	T	13: 34,050,329	I143L	probably benign	Het
C130079G13Rik	T	C	3: 59,932,693	I62T	possibly damaging	Het
Ccdc58	A	G	16: 36,072,121	E12G	probably benign	Het
Cd33	A	T	7: 43,532,726	H98Q	probably benign	Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Colec10	A	G	15: 54,462,365	D197G	probably damaging	Het
Cpt1a	T	C	19: 3,383,795	M759T	probably benign	Het
Ctc1	A	G	11: 69,022,767	Y165C	probably damaging	Het
Cyp2t4	G	A	7: 27,155,292	V66M	possibly damaging	Het
Dnah2	T	C	11: 69,454,382	D2667G	possibly damaging	Het
Dok1	T	C	6: 83,032,991	K46E	probably damaging	Het
Erv3	C	A	2: 131,856,055	W128L	possibly damaging	Het
Fam186a	A	G	15: 99,946,885	S493P	unknown	Het
Fbn1	A	T	2: 125,319,064	N2185K	probably damaging	Het
Figla	A	C	6: 86,020,707	H139P	probably benign	Het
Gemin4	A	G	11: 76,210,923	L1004P	probably damaging	Het
Gm11937	T	C	11: 99,609,820	T124A	unknown	Het
Gm17669	G	T	18: 67,562,612	V76L	probably benign	Het
Gm8765	T	A	13: 50,701,429	S368T	possibly damaging	Het
Hcls1	A	T	16: 36,957,340	M274L	probably benign	Het
Hist2h2ab	A	G	3: 96,220,085	E57G	probably damaging	Het
Il17rc	T	C	6: 113,472,780	S116P	probably damaging	Het
Krt79	G	A	15: 101,931,853	R303C	probably damaging	Het
Lamb2	C	T	9: 108,480,807	T149I	probably damaging	Het
Lrrc41	T	A	4: 116,075,609		probably null	Het
Mga	C	A	2: 119,951,195	T2234K	possibly damaging	Het
Muc6	T	A	7: 141,651,133	Q205L	probably damaging	Het
Nlrp9b	A	T	7: 20,026,537	K624N	possibly damaging	Het
Olfr463	C	T	11: 87,893,256	V223M	probably benign	Het
Olfr49	T	C	14: 54,282,680	T72A	probably damaging	Het
Olfr99	G	T	17: 37,280,495		probably benign	Het
Otud4	T	C	8: 79,673,458	S934P	probably damaging	Het
Pcdha12	G	T	18: 37,022,473	W748C	probably damaging	Het
Pdc	T	C	1: 150,333,168	I134T	probably damaging	Het
Peg10	T	TCCC	6: 4,756,451		probably benign	Het
Pkn1	C	T	8: 83,684,170	R276Q	possibly damaging	Het
Plin3	C	A	17: 56,280,824	G297V	probably benign	Het
Podn	C	T	4: 108,018,909	V517I	probably benign	Het
Pomk	T	C	8: 25,983,316	D203G	probably damaging	Het
Ppil4	A	G	10: 7,799,591	D168G	probably damaging	Het
Ptgr2	T	C	12: 84,307,873	I276T	probably benign	Het
Ptk7	T	A	17: 46,576,818	I563F	possibly damaging	Het
Rbm12	G	T	2: 156,097,818	T178K	unknown	Het
Sctr	T	C	1: 120,031,673		probably null	Het
Sh2b1	GGGACC	GGGACCGGCTCAGCCACGTGGACC	7: 126,467,572		probably benign	Het
Steap1	A	T	5: 5,736,458	D326E	probably damaging	Het
Stra6	G	A	9: 58,151,892	V513I	probably benign	Het
Tcea3	T	A	4: 136,264,574	C190S	probably damaging	Het
Tfr2	G	A	5: 137,574,439	V171I	probably benign	Het
Tm7sf3	C	T	6: 146,623,681	D89N	possibly damaging	Het
Tmem129	A	G	5: 33,657,778	V17A	probably benign	Het
Tmem2	T	A	19: 21,801,885	V353D	probably damaging	Het
Tmem87b	T	C	2: 128,818,433	L32P	probably damaging	Het
Tor1aip1	T	A	1: 156,030,431	D205V	probably damaging	Het
Trim33	T	C	3: 103,331,758	V684A	probably benign	Het
Triobp	C	T	15: 78,993,178	R1637C	probably damaging	Het
Uhrf1bp1	A	G	17: 27,893,440	D1201G	probably damaging	Het
Ulbp1	C	A	10: 7,456,371	M196I	probably benign	Het
Vash1	G	A	12: 86,691,889	G370E	probably damaging	Het
Vmn2r23	A	G	6: 123,712,713	T183A	probably benign	Het
Vta1	A	G	10: 14,655,839	I264T	probably benign	Het
Zcchc8	A	T	5: 123,700,570	M635K	probably benign	Het

Other mutations in Tbx19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Tbx19	APN	1	165160399	missense	probably benign	0.05
IGL00849:Tbx19	APN	1	165152040	missense	probably benign	0.08
IGL01545:Tbx19	APN	1	165139156	missense	possibly damaging	0.77
IGL01893:Tbx19	APN	1	165140198	missense	possibly damaging	0.93
IGL02451:Tbx19	APN	1	165140171	missense	probably benign	0.03
IGL02514:Tbx19	APN	1	165153704	missense	probably benign	0.15
G1citation:Tbx19	UTSW	1	165140140	missense	probably damaging	0.98
R0009:Tbx19	UTSW	1	165160520	missense	possibly damaging	0.93
R0009:Tbx19	UTSW	1	165160520	missense	possibly damaging	0.93
R1600:Tbx19	UTSW	1	165142567	missense	possibly damaging	0.52
R4605:Tbx19	UTSW	1	165153584	missense	possibly damaging	0.87
R5410:Tbx19	UTSW	1	165160372	missense	probably damaging	0.99
R5441:Tbx19	UTSW	1	165153680	missense	probably damaging	0.99
R6814:Tbx19	UTSW	1	165147633	critical splice donor site	probably null
R6822:Tbx19	UTSW	1	165140140	missense	probably damaging	0.98
R6872:Tbx19	UTSW	1	165147633	critical splice donor site	probably null
R7078:Tbx19	UTSW	1	165160566	start gained	probably benign
R7711:Tbx19	UTSW	1	165139199	missense	probably benign
R8882:Tbx19	UTSW	1	165139211	missense	probably benign	0.41
R9222:Tbx19	UTSW	1	165139040	missense	probably benign	0.01
R9448:Tbx19	UTSW	1	165153521	missense	probably damaging	1.00
R9514:Tbx19	UTSW	1	165138977	missense	unknown
R9680:Tbx19	UTSW	1	165142498	missense	probably damaging	0.99
Z1176:Tbx19	UTSW	1	165142507	missense	probably damaging	0.99
Z1177:Tbx19	UTSW	1	165142574	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTTGCAACCTAAGCGTGGCC -3'
(R):5'- GAACCCTGCTGTCACTTCAC -3'

Sequencing Primer
(F):5'- CTAAGCGTGGCCAAGATAAATC -3'
(R):5'- TGCTGTCACTTCACCTTCC -3'

Posted On

2022-07-18