Incidental Mutation 'R9495:Tbx19'
ID 717133
Institutional Source Beutler Lab
Gene Symbol Tbx19
Ensembl Gene ENSMUSG00000026572
Gene Name T-box 19
Synonyms Tpit, D1Ertd754e
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.797) question?
Stock # R9495 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 165137855-165160773 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 165138977 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 443 (S443P)
Ref Sequence ENSEMBL: ENSMUSP00000027859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027859]
AlphaFold Q99ME7
Predicted Effect unknown
Transcript: ENSMUST00000027859
AA Change: S443P
SMART Domains Protein: ENSMUSP00000027859
Gene: ENSMUSG00000026572
AA Change: S443P

DomainStartEndE-ValueType
TBOX 38 221 1.26e-114 SMART
low complexity region 263 275 N/A INTRINSIC
Blast:TBOX 343 410 2e-18 BLAST
low complexity region 424 443 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161144
AA Change: S314P
SMART Domains Protein: ENSMUSP00000123909
Gene: ENSMUSG00000026572
AA Change: S314P

DomainStartEndE-ValueType
TBOX 1 156 4.56e-80 SMART
Blast:TBOX 215 282 5e-19 BLAST
low complexity region 296 315 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a family of transcription factors containing a characteristic T-box DNA-binding domain. The encoded protein promotes expression of the pro-opiomelanocortin (POMC) gene, which is important for the differentiation of cells in the pituitary gland. [provided by RefSeq, Mar 2013]
PHENOTYPE: The phenotype of homozygous null mice is similar to that of patients with early onset pituitary ACTH deficiency. They are characterized by fasting-induced hypoglycemia due to an impaired pituitary-adrenal axis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik C T 8: 45,956,421 S287N probably damaging Het
1700088E04Rik T A 15: 79,135,642 D158V probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Acp5 G A 9: 22,127,187 Q273* probably null Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Atp2b1 T A 10: 98,999,798 N468K probably damaging Het
Bphl A T 13: 34,050,329 I143L probably benign Het
C130079G13Rik T C 3: 59,932,693 I62T possibly damaging Het
Ccdc58 A G 16: 36,072,121 E12G probably benign Het
Cd33 A T 7: 43,532,726 H98Q probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Colec10 A G 15: 54,462,365 D197G probably damaging Het
Cpt1a T C 19: 3,383,795 M759T probably benign Het
Ctc1 A G 11: 69,022,767 Y165C probably damaging Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Dnah2 T C 11: 69,454,382 D2667G possibly damaging Het
Dok1 T C 6: 83,032,991 K46E probably damaging Het
Erv3 C A 2: 131,856,055 W128L possibly damaging Het
Fam186a A G 15: 99,946,885 S493P unknown Het
Fbn1 A T 2: 125,319,064 N2185K probably damaging Het
Figla A C 6: 86,020,707 H139P probably benign Het
Gemin4 A G 11: 76,210,923 L1004P probably damaging Het
Gm11937 T C 11: 99,609,820 T124A unknown Het
Gm17669 G T 18: 67,562,612 V76L probably benign Het
Gm8765 T A 13: 50,701,429 S368T possibly damaging Het
Hcls1 A T 16: 36,957,340 M274L probably benign Het
Hist2h2ab A G 3: 96,220,085 E57G probably damaging Het
Il17rc T C 6: 113,472,780 S116P probably damaging Het
Krt79 G A 15: 101,931,853 R303C probably damaging Het
Lamb2 C T 9: 108,480,807 T149I probably damaging Het
Lrrc41 T A 4: 116,075,609 probably null Het
Mga C A 2: 119,951,195 T2234K possibly damaging Het
Muc6 T A 7: 141,651,133 Q205L probably damaging Het
Nlrp9b A T 7: 20,026,537 K624N possibly damaging Het
Olfr463 C T 11: 87,893,256 V223M probably benign Het
Olfr49 T C 14: 54,282,680 T72A probably damaging Het
Olfr99 G T 17: 37,280,495 probably benign Het
Otud4 T C 8: 79,673,458 S934P probably damaging Het
Pcdha12 G T 18: 37,022,473 W748C probably damaging Het
Pdc T C 1: 150,333,168 I134T probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Pkn1 C T 8: 83,684,170 R276Q possibly damaging Het
Plin3 C A 17: 56,280,824 G297V probably benign Het
Podn C T 4: 108,018,909 V517I probably benign Het
Pomk T C 8: 25,983,316 D203G probably damaging Het
Ppil4 A G 10: 7,799,591 D168G probably damaging Het
Ptgr2 T C 12: 84,307,873 I276T probably benign Het
Ptk7 T A 17: 46,576,818 I563F possibly damaging Het
Rbm12 G T 2: 156,097,818 T178K unknown Het
Sctr T C 1: 120,031,673 probably null Het
Sh2b1 GGGACC GGGACCGGCTCAGCCACGTGGACC 7: 126,467,572 probably benign Het
Steap1 A T 5: 5,736,458 D326E probably damaging Het
Stra6 G A 9: 58,151,892 V513I probably benign Het
Tcea3 T A 4: 136,264,574 C190S probably damaging Het
Tfr2 G A 5: 137,574,439 V171I probably benign Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem129 A G 5: 33,657,778 V17A probably benign Het
Tmem2 T A 19: 21,801,885 V353D probably damaging Het
Tmem87b T C 2: 128,818,433 L32P probably damaging Het
Tor1aip1 T A 1: 156,030,431 D205V probably damaging Het
Trim33 T C 3: 103,331,758 V684A probably benign Het
Triobp C T 15: 78,993,178 R1637C probably damaging Het
Uhrf1bp1 A G 17: 27,893,440 D1201G probably damaging Het
Ulbp1 C A 10: 7,456,371 M196I probably benign Het
Vash1 G A 12: 86,691,889 G370E probably damaging Het
Vmn2r23 A G 6: 123,712,713 T183A probably benign Het
Vta1 A G 10: 14,655,839 I264T probably benign Het
Zcchc8 A T 5: 123,700,570 M635K probably benign Het
Other mutations in Tbx19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Tbx19 APN 1 165160399 missense probably benign 0.05
IGL00849:Tbx19 APN 1 165152040 missense probably benign 0.08
IGL01545:Tbx19 APN 1 165139156 missense possibly damaging 0.77
IGL01893:Tbx19 APN 1 165140198 missense possibly damaging 0.93
IGL02451:Tbx19 APN 1 165140171 missense probably benign 0.03
IGL02514:Tbx19 APN 1 165153704 missense probably benign 0.15
G1citation:Tbx19 UTSW 1 165140140 missense probably damaging 0.98
R0009:Tbx19 UTSW 1 165160520 missense possibly damaging 0.93
R0009:Tbx19 UTSW 1 165160520 missense possibly damaging 0.93
R1600:Tbx19 UTSW 1 165142567 missense possibly damaging 0.52
R4605:Tbx19 UTSW 1 165153584 missense possibly damaging 0.87
R5410:Tbx19 UTSW 1 165160372 missense probably damaging 0.99
R5441:Tbx19 UTSW 1 165153680 missense probably damaging 0.99
R6814:Tbx19 UTSW 1 165147633 critical splice donor site probably null
R6822:Tbx19 UTSW 1 165140140 missense probably damaging 0.98
R6872:Tbx19 UTSW 1 165147633 critical splice donor site probably null
R7078:Tbx19 UTSW 1 165160566 start gained probably benign
R7711:Tbx19 UTSW 1 165139199 missense probably benign
R8882:Tbx19 UTSW 1 165139211 missense probably benign 0.41
R9222:Tbx19 UTSW 1 165139040 missense probably benign 0.01
R9448:Tbx19 UTSW 1 165153521 missense probably damaging 1.00
R9514:Tbx19 UTSW 1 165138977 missense unknown
R9680:Tbx19 UTSW 1 165142498 missense probably damaging 0.99
Z1176:Tbx19 UTSW 1 165142507 missense probably damaging 0.99
Z1177:Tbx19 UTSW 1 165142574 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTGCAACCTAAGCGTGGCC -3'
(R):5'- GAACCCTGCTGTCACTTCAC -3'

Sequencing Primer
(F):5'- CTAAGCGTGGCCAAGATAAATC -3'
(R):5'- TGCTGTCACTTCACCTTCC -3'
Posted On 2022-07-18