Incidental Mutation 'R9495:Mga'
ID 717134
Institutional Source Beutler Lab
Gene Symbol Mga
Ensembl Gene ENSMUSG00000033943
Gene Name MAX gene associated
Synonyms D030062C11Rik, Mga, Mad5, C130042M01Rik
Accession Numbers

Ncbi RefSeq: NM_013720.2, NM_001164274.1; MGI: 1352483

Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock # R9495 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 119897228-119969581 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 119951195 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 2234 (T2234K)
Ref Sequence ENSEMBL: ENSMUSP00000106400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046717] [ENSMUST00000079934] [ENSMUST00000110773] [ENSMUST00000110774] [ENSMUST00000156510]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000046717
AA Change: T2313K

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000043795
Gene: ENSMUSG00000033943
AA Change: T2313K

DomainStartEndE-ValueType
Blast:TBOX 6 73 6e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1796 1818 N/A INTRINSIC
low complexity region 1833 1850 N/A INTRINSIC
low complexity region 1977 1992 N/A INTRINSIC
low complexity region 2183 2197 N/A INTRINSIC
low complexity region 2241 2259 N/A INTRINSIC
HLH 2368 2419 8.27e-7 SMART
low complexity region 2748 2769 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079934
AA Change: T2143K

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078853
Gene: ENSMUSG00000033943
AA Change: T2143K

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
low complexity region 2578 2599 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110773
AA Change: T2234K

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106400
Gene: ENSMUSG00000033943
AA Change: T2234K

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 890 899 N/A INTRINSIC
low complexity region 938 952 N/A INTRINSIC
low complexity region 1033 1059 N/A INTRINSIC
low complexity region 1169 1190 N/A INTRINSIC
low complexity region 1222 1236 N/A INTRINSIC
low complexity region 1485 1502 N/A INTRINSIC
low complexity region 1555 1570 N/A INTRINSIC
low complexity region 1602 1637 N/A INTRINSIC
low complexity region 1717 1739 N/A INTRINSIC
low complexity region 1754 1771 N/A INTRINSIC
low complexity region 1898 1913 N/A INTRINSIC
low complexity region 2104 2118 N/A INTRINSIC
low complexity region 2162 2180 N/A INTRINSIC
HLH 2289 2340 8.27e-7 SMART
low complexity region 2669 2690 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110774
AA Change: T2352K

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106401
Gene: ENSMUSG00000033943
AA Change: T2352K

DomainStartEndE-ValueType
Blast:TBOX 6 73 7e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
Pfam:DUF4801 1037 1085 1e-19 PFAM
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1835 1857 N/A INTRINSIC
low complexity region 1872 1889 N/A INTRINSIC
low complexity region 2016 2031 N/A INTRINSIC
low complexity region 2222 2236 N/A INTRINSIC
low complexity region 2280 2298 N/A INTRINSIC
HLH 2407 2458 8.27e-7 SMART
low complexity region 2787 2808 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156074
Predicted Effect probably benign
Transcript: ENSMUST00000156510
AA Change: T2143K

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119044
Gene: ENSMUSG00000033943
AA Change: T2143K

DomainStartEndE-ValueType
Blast:TBOX 6 73 4e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Embryos homozygous for a gene trap allele die shortly after implantation due to defective development of the inner cell mass (ICM) and the epiblast. ICM derivatives fail to develop past E4.5 and show increased apoptosis but no change in cell proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(135) : Gene trapped(135)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik C T 8: 45,956,421 S287N probably damaging Het
1700088E04Rik T A 15: 79,135,642 D158V probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Acp5 G A 9: 22,127,187 Q273* probably null Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Atp2b1 T A 10: 98,999,798 N468K probably damaging Het
Bphl A T 13: 34,050,329 I143L probably benign Het
C130079G13Rik T C 3: 59,932,693 I62T possibly damaging Het
Ccdc58 A G 16: 36,072,121 E12G probably benign Het
Cd33 A T 7: 43,532,726 H98Q probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Colec10 A G 15: 54,462,365 D197G probably damaging Het
Cpt1a T C 19: 3,383,795 M759T probably benign Het
Ctc1 A G 11: 69,022,767 Y165C probably damaging Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Dnah2 T C 11: 69,454,382 D2667G possibly damaging Het
Dok1 T C 6: 83,032,991 K46E probably damaging Het
Erv3 C A 2: 131,856,055 W128L possibly damaging Het
Fam186a A G 15: 99,946,885 S493P unknown Het
Fbn1 A T 2: 125,319,064 N2185K probably damaging Het
Figla A C 6: 86,020,707 H139P probably benign Het
Gemin4 A G 11: 76,210,923 L1004P probably damaging Het
Gm11937 T C 11: 99,609,820 T124A unknown Het
Gm17669 G T 18: 67,562,612 V76L probably benign Het
Gm8765 T A 13: 50,701,429 S368T possibly damaging Het
Hcls1 A T 16: 36,957,340 M274L probably benign Het
Hist2h2ab A G 3: 96,220,085 E57G probably damaging Het
Il17rc T C 6: 113,472,780 S116P probably damaging Het
Krt79 G A 15: 101,931,853 R303C probably damaging Het
Lamb2 C T 9: 108,480,807 T149I probably damaging Het
Lrrc41 T A 4: 116,075,609 probably null Het
Muc6 T A 7: 141,651,133 Q205L probably damaging Het
Nlrp9b A T 7: 20,026,537 K624N possibly damaging Het
Olfr463 C T 11: 87,893,256 V223M probably benign Het
Olfr49 T C 14: 54,282,680 T72A probably damaging Het
Olfr99 G T 17: 37,280,495 probably benign Het
Otud4 T C 8: 79,673,458 S934P probably damaging Het
Pcdha12 G T 18: 37,022,473 W748C probably damaging Het
Pdc T C 1: 150,333,168 I134T probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Pkn1 C T 8: 83,684,170 R276Q possibly damaging Het
Plin3 C A 17: 56,280,824 G297V probably benign Het
Podn C T 4: 108,018,909 V517I probably benign Het
Pomk T C 8: 25,983,316 D203G probably damaging Het
Ppil4 A G 10: 7,799,591 D168G probably damaging Het
Ptgr2 T C 12: 84,307,873 I276T probably benign Het
Ptk7 T A 17: 46,576,818 I563F possibly damaging Het
Rbm12 G T 2: 156,097,818 T178K unknown Het
Sctr T C 1: 120,031,673 probably null Het
Sh2b1 GGGACC GGGACCGGCTCAGCCACGTGGACC 7: 126,467,572 probably benign Het
Steap1 A T 5: 5,736,458 D326E probably damaging Het
Stra6 G A 9: 58,151,892 V513I probably benign Het
Tbx19 A G 1: 165,138,977 S443P unknown Het
Tcea3 T A 4: 136,264,574 C190S probably damaging Het
Tfr2 G A 5: 137,574,439 V171I probably benign Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem129 A G 5: 33,657,778 V17A probably benign Het
Tmem2 T A 19: 21,801,885 V353D probably damaging Het
Tmem87b T C 2: 128,818,433 L32P probably damaging Het
Tor1aip1 T A 1: 156,030,431 D205V probably damaging Het
Trim33 T C 3: 103,331,758 V684A probably benign Het
Triobp C T 15: 78,993,178 R1637C probably damaging Het
Uhrf1bp1 A G 17: 27,893,440 D1201G probably damaging Het
Ulbp1 C A 10: 7,456,371 M196I probably benign Het
Vash1 G A 12: 86,691,889 G370E probably damaging Het
Vmn2r23 A G 6: 123,712,713 T183A probably benign Het
Vta1 A G 10: 14,655,839 I264T probably benign Het
Zcchc8 A T 5: 123,700,570 M635K probably benign Het
Other mutations in Mga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Mga APN 2 119919814 missense possibly damaging 0.65
IGL00719:Mga APN 2 119947453 nonsense probably null
IGL01619:Mga APN 2 119931828 missense possibly damaging 0.46
IGL01721:Mga APN 2 119935239 missense probably damaging 1.00
IGL01759:Mga APN 2 119951195 missense possibly damaging 0.92
IGL01785:Mga APN 2 119902912 missense probably damaging 1.00
IGL01786:Mga APN 2 119902912 missense probably damaging 1.00
IGL01950:Mga APN 2 119941654 missense possibly damaging 0.60
IGL01960:Mga APN 2 119938657 missense probably damaging 1.00
IGL02086:Mga APN 2 119924036 missense probably damaging 0.99
IGL02364:Mga APN 2 119964054 missense possibly damaging 0.66
IGL02602:Mga APN 2 119931884 missense possibly damaging 0.66
IGL02751:Mga APN 2 119947770 missense possibly damaging 0.82
IGL02794:Mga APN 2 119946289 missense possibly damaging 0.84
IGL03247:Mga APN 2 119935513 missense possibly damaging 0.81
IGL03303:Mga APN 2 119903452 missense probably damaging 1.00
PIT4515001:Mga UTSW 2 119916504 missense probably damaging 1.00
R0060:Mga UTSW 2 119960961 critical splice donor site probably null
R0060:Mga UTSW 2 119960961 critical splice donor site probably null
R0417:Mga UTSW 2 119902790 missense probably damaging 0.99
R0449:Mga UTSW 2 119941381 missense probably damaging 1.00
R0457:Mga UTSW 2 119916488 missense probably damaging 0.98
R0538:Mga UTSW 2 119919706 critical splice donor site probably null
R0568:Mga UTSW 2 119935422 missense probably damaging 1.00
R0614:Mga UTSW 2 119964466 missense probably damaging 1.00
R0671:Mga UTSW 2 119919910 splice site probably null
R0811:Mga UTSW 2 119947961 missense probably damaging 0.99
R0812:Mga UTSW 2 119947961 missense probably damaging 0.99
R0948:Mga UTSW 2 119941659 missense possibly damaging 0.77
R1177:Mga UTSW 2 119926446 missense probably damaging 1.00
R1445:Mga UTSW 2 119902698 missense probably damaging 1.00
R1476:Mga UTSW 2 119941675 missense probably damaging 0.96
R1527:Mga UTSW 2 119916597 missense probably damaging 1.00
R1583:Mga UTSW 2 119963960 missense possibly damaging 0.66
R1592:Mga UTSW 2 119964666 missense possibly damaging 0.93
R1627:Mga UTSW 2 119964562 missense probably damaging 1.00
R1658:Mga UTSW 2 119941689 missense possibly damaging 0.63
R1677:Mga UTSW 2 119960852 missense possibly damaging 0.92
R1887:Mga UTSW 2 119923617 missense probably damaging 1.00
R1908:Mga UTSW 2 119926594 missense possibly damaging 0.66
R1909:Mga UTSW 2 119926594 missense possibly damaging 0.66
R2061:Mga UTSW 2 119964980 unclassified probably benign
R2145:Mga UTSW 2 119964157 missense possibly damaging 0.85
R2159:Mga UTSW 2 119919643 missense probably damaging 0.96
R2179:Mga UTSW 2 119960442 missense probably damaging 0.99
R2281:Mga UTSW 2 119903723 missense probably benign
R2423:Mga UTSW 2 119964793 missense probably damaging 1.00
R3620:Mga UTSW 2 119916668 missense probably damaging 1.00
R3622:Mga UTSW 2 119941764 missense probably damaging 1.00
R3624:Mga UTSW 2 119941764 missense probably damaging 1.00
R3802:Mga UTSW 2 119947339 missense probably damaging 0.96
R4011:Mga UTSW 2 119931780 missense probably damaging 1.00
R4065:Mga UTSW 2 119947002 missense probably damaging 1.00
R4520:Mga UTSW 2 119948098 missense possibly damaging 0.85
R4649:Mga UTSW 2 119941493 missense possibly damaging 0.81
R4660:Mga UTSW 2 119938623 intron probably benign
R4757:Mga UTSW 2 119903639 missense possibly damaging 0.82
R4771:Mga UTSW 2 119964294 missense probably damaging 1.00
R4784:Mga UTSW 2 119903057 missense probably damaging 1.00
R4866:Mga UTSW 2 119964054 missense possibly damaging 0.66
R4900:Mga UTSW 2 119964054 missense possibly damaging 0.66
R4952:Mga UTSW 2 119903301 missense probably damaging 1.00
R4995:Mga UTSW 2 119932582 nonsense probably null
R5020:Mga UTSW 2 119951173 nonsense probably null
R5082:Mga UTSW 2 119903344 missense probably damaging 0.98
R5208:Mga UTSW 2 119947981 missense possibly damaging 0.83
R5454:Mga UTSW 2 119903329 missense probably damaging 0.99
R5466:Mga UTSW 2 119902697 missense probably damaging 1.00
R5484:Mga UTSW 2 119916626 missense possibly damaging 0.58
R5669:Mga UTSW 2 119903426 missense probably damaging 1.00
R5819:Mga UTSW 2 119941263 missense possibly damaging 0.61
R5916:Mga UTSW 2 119964312 missense probably benign 0.27
R5942:Mga UTSW 2 119946959 missense probably benign 0.41
R6305:Mga UTSW 2 119947698 missense probably benign 0.00
R6434:Mga UTSW 2 119923938 missense probably damaging 0.99
R6467:Mga UTSW 2 119946295 missense probably damaging 1.00
R6488:Mga UTSW 2 119960907 missense probably damaging 1.00
R6630:Mga UTSW 2 119923659 missense probably damaging 0.99
R6790:Mga UTSW 2 119923754 missense probably damaging 0.99
R7029:Mga UTSW 2 119923550 missense probably damaging 1.00
R7039:Mga UTSW 2 119932678 missense probably benign 0.28
R7088:Mga UTSW 2 119961936 missense probably damaging 1.00
R7195:Mga UTSW 2 119917328 missense probably damaging 1.00
R7273:Mga UTSW 2 119935214 missense probably damaging 1.00
R7286:Mga UTSW 2 119964788 missense possibly damaging 0.93
R7346:Mga UTSW 2 119935527 missense possibly damaging 0.56
R7383:Mga UTSW 2 119960340 missense probably damaging 0.99
R7469:Mga UTSW 2 119903046 missense probably damaging 1.00
R7484:Mga UTSW 2 119946229 missense probably damaging 0.99
R7537:Mga UTSW 2 119935551 missense probably damaging 0.97
R7781:Mga UTSW 2 119917357 missense probably damaging 1.00
R7921:Mga UTSW 2 119919678 missense probably damaging 1.00
R8165:Mga UTSW 2 119947238 missense probably benign 0.12
R8226:Mga UTSW 2 119960385 missense probably benign 0.33
R8305:Mga UTSW 2 119946319 missense possibly damaging 0.77
R8309:Mga UTSW 2 119960930 missense probably damaging 1.00
R8363:Mga UTSW 2 119963926 missense probably benign 0.43
R8388:Mga UTSW 2 119964081 missense probably benign 0.00
R8524:Mga UTSW 2 119941516 missense probably damaging 0.97
R8693:Mga UTSW 2 119963926 missense possibly damaging 0.65
R8837:Mga UTSW 2 119938791 splice site probably benign
R8916:Mga UTSW 2 119958338 missense possibly damaging 0.92
R8936:Mga UTSW 2 119964228 missense probably damaging 1.00
R9028:Mga UTSW 2 119947589 missense probably benign
R9145:Mga UTSW 2 119964012 missense probably benign
R9155:Mga UTSW 2 119926532 missense probably damaging 1.00
R9308:Mga UTSW 2 119923888 missense possibly damaging 0.91
R9342:Mga UTSW 2 119948175 missense probably benign
R9347:Mga UTSW 2 119903037 missense probably damaging 1.00
R9390:Mga UTSW 2 119963851 missense probably damaging 0.99
R9408:Mga UTSW 2 119935518 missense possibly damaging 0.92
R9488:Mga UTSW 2 119964823 missense possibly damaging 0.90
R9521:Mga UTSW 2 119964498 missense probably damaging 0.99
R9780:Mga UTSW 2 119916772 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TAGCTGGTTTAATAAGGGAGCATG -3'
(R):5'- TTGTTAGCAAAGGCCAAAGC -3'

Sequencing Primer
(F):5'- GCATGTGATTGAAAAGTTTAGGTATG -3'
(R):5'- TAGCAAAGGCCAAAGCAAGTAAATTC -3'
Posted On 2022-07-18