Incidental Mutation 'R9495:Zcchc8'
ID 717147
Institutional Source Beutler Lab
Gene Symbol Zcchc8
Ensembl Gene ENSMUSG00000029427
Gene Name zinc finger, CCHC domain containing 8
Synonyms 5730565F05Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.328) question?
Stock # R9495 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 123836365-123859107 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123838633 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 635 (M635K)
Ref Sequence ENSEMBL: ENSMUSP00000031376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031376] [ENSMUST00000196282]
AlphaFold Q9CYA6
Predicted Effect probably benign
Transcript: ENSMUST00000031376
AA Change: M635K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031376
Gene: ENSMUSG00000029427
AA Change: M635K

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 48 83 N/A INTRINSIC
ZnF_C2HC 231 247 4.13e-3 SMART
PSP 286 338 3.04e-27 SMART
low complexity region 410 434 N/A INTRINSIC
low complexity region 464 500 N/A INTRINSIC
low complexity region 520 527 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196282
AA Change: M635K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142363
Gene: ENSMUSG00000029427
AA Change: M635K

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 48 83 N/A INTRINSIC
ZnF_C2HC 231 247 4.13e-3 SMART
PSP 286 338 3.04e-27 SMART
low complexity region 410 434 N/A INTRINSIC
low complexity region 464 500 N/A INTRINSIC
low complexity region 520 527 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198826
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI

All alleles(12) : Gene trapped(12)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T A 15: 79,019,842 (GRCm39) D158V probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
Aadacl2fm1 T C 3: 59,840,114 (GRCm39) I62T possibly damaging Het
Acp5 G A 9: 22,038,483 (GRCm39) Q273* probably null Het
Apoa5 G C 9: 46,181,944 (GRCm39) R340P probably damaging Het
Atp2b1 T A 10: 98,835,660 (GRCm39) N468K probably damaging Het
Bltp3a A G 17: 28,112,414 (GRCm39) D1201G probably damaging Het
Bphl A T 13: 34,234,312 (GRCm39) I143L probably benign Het
Cd33 A T 7: 43,182,150 (GRCm39) H98Q probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Cemip2 T A 19: 21,779,249 (GRCm39) V353D probably damaging Het
Cfap96 C T 8: 46,409,458 (GRCm39) S287N probably damaging Het
Colec10 A G 15: 54,325,761 (GRCm39) D197G probably damaging Het
Cpt1a T C 19: 3,433,795 (GRCm39) M759T probably benign Het
Ctc1 A G 11: 68,913,593 (GRCm39) Y165C probably damaging Het
Cyp2t4 G A 7: 26,854,717 (GRCm39) V66M possibly damaging Het
Dnah2 T C 11: 69,345,208 (GRCm39) D2667G possibly damaging Het
Dok1 T C 6: 83,009,972 (GRCm39) K46E probably damaging Het
Erv3 C A 2: 131,697,975 (GRCm39) W128L possibly damaging Het
Fam186a A G 15: 99,844,766 (GRCm39) S493P unknown Het
Fbn1 A T 2: 125,160,984 (GRCm39) N2185K probably damaging Het
Figla A C 6: 85,997,689 (GRCm39) H139P probably benign Het
Gemin4 A G 11: 76,101,749 (GRCm39) L1004P probably damaging Het
Gm11937 T C 11: 99,500,646 (GRCm39) T124A unknown Het
Gm17669 G T 18: 67,695,682 (GRCm39) V76L probably benign Het
H2ac21 A G 3: 96,127,401 (GRCm39) E57G probably damaging Het
Hcls1 A T 16: 36,777,702 (GRCm39) M274L probably benign Het
Il17rc T C 6: 113,449,741 (GRCm39) S116P probably damaging Het
Krt79 G A 15: 101,840,288 (GRCm39) R303C probably damaging Het
Lamb2 C T 9: 108,358,006 (GRCm39) T149I probably damaging Het
Lrrc41 T A 4: 115,932,806 (GRCm39) probably null Het
Mga C A 2: 119,781,676 (GRCm39) T2234K possibly damaging Het
Mix23 A G 16: 35,892,491 (GRCm39) E12G probably benign Het
Muc6 T A 7: 141,237,398 (GRCm39) Q205L probably damaging Het
Nlrp9b A T 7: 19,760,462 (GRCm39) K624N possibly damaging Het
Or1o4 G T 17: 37,591,386 (GRCm39) probably benign Het
Or4d2 C T 11: 87,784,082 (GRCm39) V223M probably benign Het
Or6e1 T C 14: 54,520,137 (GRCm39) T72A probably damaging Het
Otud4 T C 8: 80,400,087 (GRCm39) S934P probably damaging Het
Pcdha12 G T 18: 37,155,526 (GRCm39) W748C probably damaging Het
Pdc T C 1: 150,208,919 (GRCm39) I134T probably damaging Het
Peg10 T TCCC 6: 4,756,451 (GRCm39) probably benign Het
Pkn1 C T 8: 84,410,799 (GRCm39) R276Q possibly damaging Het
Plin3 C A 17: 56,587,824 (GRCm39) G297V probably benign Het
Podn C T 4: 107,876,106 (GRCm39) V517I probably benign Het
Pomk T C 8: 26,473,344 (GRCm39) D203G probably damaging Het
Ppil4 A G 10: 7,675,355 (GRCm39) D168G probably damaging Het
Ptgr2 T C 12: 84,354,647 (GRCm39) I276T probably benign Het
Ptk7 T A 17: 46,887,744 (GRCm39) I563F possibly damaging Het
Rbm12 G T 2: 155,939,738 (GRCm39) T178K unknown Het
Sctr T C 1: 119,959,403 (GRCm39) probably null Het
Sh2b1 GGGACC GGGACCGGCTCAGCCACGTGGACC 7: 126,066,744 (GRCm39) probably benign Het
Spata31e4 T A 13: 50,855,465 (GRCm39) S368T possibly damaging Het
Steap1 A T 5: 5,786,458 (GRCm39) D326E probably damaging Het
Stra6 G A 9: 58,059,175 (GRCm39) V513I probably benign Het
Tbx19 A G 1: 164,966,546 (GRCm39) S443P unknown Het
Tcea3 T A 4: 135,991,885 (GRCm39) C190S probably damaging Het
Tfr2 G A 5: 137,572,701 (GRCm39) V171I probably benign Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tmem129 A G 5: 33,815,122 (GRCm39) V17A probably benign Het
Tmem87b T C 2: 128,660,353 (GRCm39) L32P probably damaging Het
Tor1aip1 T A 1: 155,906,177 (GRCm39) D205V probably damaging Het
Trim33 T C 3: 103,239,074 (GRCm39) V684A probably benign Het
Triobp C T 15: 78,877,378 (GRCm39) R1637C probably damaging Het
Ulbp1 C A 10: 7,406,371 (GRCm39) M196I probably benign Het
Vash1 G A 12: 86,738,663 (GRCm39) G370E probably damaging Het
Vmn2r23 A G 6: 123,689,672 (GRCm39) T183A probably benign Het
Vta1 A G 10: 14,531,583 (GRCm39) I264T probably benign Het
Other mutations in Zcchc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Zcchc8 APN 5 123,842,632 (GRCm39) missense probably benign 0.43
IGL01536:Zcchc8 APN 5 123,858,782 (GRCm39) critical splice donor site probably null
IGL02083:Zcchc8 APN 5 123,838,981 (GRCm39) missense probably damaging 1.00
IGL02838:Zcchc8 APN 5 123,857,546 (GRCm39) splice site probably benign
3-1:Zcchc8 UTSW 5 123,847,544 (GRCm39) missense probably damaging 1.00
PIT4515001:Zcchc8 UTSW 5 123,838,995 (GRCm39) missense probably benign 0.23
R0127:Zcchc8 UTSW 5 123,845,400 (GRCm39) missense probably damaging 1.00
R1134:Zcchc8 UTSW 5 123,855,090 (GRCm39) missense probably damaging 1.00
R1604:Zcchc8 UTSW 5 123,838,721 (GRCm39) missense probably benign 0.00
R1744:Zcchc8 UTSW 5 123,838,436 (GRCm39) nonsense probably null
R2216:Zcchc8 UTSW 5 123,845,466 (GRCm39) missense probably damaging 1.00
R2303:Zcchc8 UTSW 5 123,838,660 (GRCm39) missense probably benign 0.00
R2877:Zcchc8 UTSW 5 123,838,766 (GRCm39) missense probably benign 0.05
R2964:Zcchc8 UTSW 5 123,858,930 (GRCm39) missense probably benign 0.00
R2966:Zcchc8 UTSW 5 123,858,930 (GRCm39) missense probably benign 0.00
R6831:Zcchc8 UTSW 5 123,838,972 (GRCm39) missense probably damaging 1.00
R7908:Zcchc8 UTSW 5 123,858,783 (GRCm39) critical splice donor site probably benign
R8738:Zcchc8 UTSW 5 123,841,070 (GRCm39) missense probably damaging 0.99
R8791:Zcchc8 UTSW 5 123,845,362 (GRCm39) missense probably benign 0.06
R9487:Zcchc8 UTSW 5 123,847,300 (GRCm39) missense probably damaging 0.99
R9508:Zcchc8 UTSW 5 123,842,584 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACAGGTTTCTTATCCTGAGGTAC -3'
(R):5'- CCCGTGTCCAAACGAGTTTG -3'

Sequencing Primer
(F):5'- AGGTACATTCCAGTGGATTCAGCC -3'
(R):5'- AAACGAGTTTGACCTCCCTG -3'
Posted On 2022-07-18