Incidental Mutation 'R9495:Peg10'
ID 717149
Institutional Source Beutler Lab
Gene Symbol Peg10
Ensembl Gene ENSMUSG00000092035
Gene Name paternally expressed 10
Synonyms HB-1, MyEF-3, Mart2, Mar2, MyEF-3 like, MEF3L, Edr
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9495 (G1)
Quality Score 122.467
Status Not validated
Chromosome 6
Chromosomal Location 4747306-4760517 bp(+) (GRCm38)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) T to TCCC at 4756451 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166678] [ENSMUST00000176204] [ENSMUST00000176551]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000166678
SMART Domains Protein: ENSMUSP00000127306
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:DUF4939 130 220 6.1e-17 PFAM
Pfam:Retrotrans_gag 174 267 2.9e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
low complexity region 368 379 N/A INTRINSIC
low complexity region 541 610 N/A INTRINSIC
low complexity region 621 660 N/A INTRINSIC
low complexity region 663 785 N/A INTRINSIC
Blast:SERPIN 798 910 1e-5 BLAST
low complexity region 923 936 N/A INTRINSIC
low complexity region 972 998 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176204
SMART Domains Protein: ENSMUSP00000134963
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:Retrotrans_gag 174 267 1.3e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176551
SMART Domains Protein: ENSMUSP00000135076
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 173 242 N/A INTRINSIC
low complexity region 253 292 N/A INTRINSIC
low complexity region 295 417 N/A INTRINSIC
Blast:SERPIN 430 542 6e-6 BLAST
low complexity region 555 568 N/A INTRINSIC
low complexity region 604 630 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This is a paternally expressed imprinted gene that is thought to have been derived from the Ty3/Gypsy family of retrotransposons. It contains two overlapping open reading frames, RF1 and RF2, and expresses two proteins: a shorter, gag-like protein (with a CCHC-type zinc finger domain) from RF1; and a longer, gag/pol-like fusion protein (with an additional aspartic protease motif) from RF1/RF2 by -1 translational frameshifting (-1 FS). While -1 FS has been observed in RNA viruses and transposons in both prokaryotes and eukaryotes, this gene represents the first example of -1 FS in a eukaryotic cellular gene. This gene is highly conserved across mammalian species and retains the heptanucleotide (GGGAAAC) and pseudoknot elements required for -1 FS. It is expressed in adult and embryonic tissues (most notably in placenta) and reported to have a role in cell proliferation, differentiation, apoptosis and cancer development. Knockout mice lacking this gene showed early embryonic lethality with placental defects, indicating the importance of this gene in embryonic development. [provided by RefSeq, Oct 2014]
PHENOTYPE: Heterozygous mice with a paternally inherited null allele display embryonic lethality during organogenesis with abnormal placental development. Heterozygous mice with a maternally inherited null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik C T 8: 45,956,421 S287N probably damaging Het
1700088E04Rik T A 15: 79,135,642 D158V probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Acp5 G A 9: 22,127,187 Q273* probably null Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Atp2b1 T A 10: 98,999,798 N468K probably damaging Het
Bphl A T 13: 34,050,329 I143L probably benign Het
C130079G13Rik T C 3: 59,932,693 I62T possibly damaging Het
Ccdc58 A G 16: 36,072,121 E12G probably benign Het
Cd33 A T 7: 43,532,726 H98Q probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Colec10 A G 15: 54,462,365 D197G probably damaging Het
Cpt1a T C 19: 3,383,795 M759T probably benign Het
Ctc1 A G 11: 69,022,767 Y165C probably damaging Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Dnah2 T C 11: 69,454,382 D2667G possibly damaging Het
Dok1 T C 6: 83,032,991 K46E probably damaging Het
Erv3 C A 2: 131,856,055 W128L possibly damaging Het
Fam186a A G 15: 99,946,885 S493P unknown Het
Fbn1 A T 2: 125,319,064 N2185K probably damaging Het
Figla A C 6: 86,020,707 H139P probably benign Het
Gemin4 A G 11: 76,210,923 L1004P probably damaging Het
Gm11937 T C 11: 99,609,820 T124A unknown Het
Gm17669 G T 18: 67,562,612 V76L probably benign Het
Gm8765 T A 13: 50,701,429 S368T possibly damaging Het
Hcls1 A T 16: 36,957,340 M274L probably benign Het
Hist2h2ab A G 3: 96,220,085 E57G probably damaging Het
Il17rc T C 6: 113,472,780 S116P probably damaging Het
Krt79 G A 15: 101,931,853 R303C probably damaging Het
Lamb2 C T 9: 108,480,807 T149I probably damaging Het
Lrrc41 T A 4: 116,075,609 probably null Het
Mga C A 2: 119,951,195 T2234K possibly damaging Het
Muc6 T A 7: 141,651,133 Q205L probably damaging Het
Nlrp9b A T 7: 20,026,537 K624N possibly damaging Het
Olfr463 C T 11: 87,893,256 V223M probably benign Het
Olfr49 T C 14: 54,282,680 T72A probably damaging Het
Olfr99 G T 17: 37,280,495 probably benign Het
Otud4 T C 8: 79,673,458 S934P probably damaging Het
Pcdha12 G T 18: 37,022,473 W748C probably damaging Het
Pdc T C 1: 150,333,168 I134T probably damaging Het
Pkn1 C T 8: 83,684,170 R276Q possibly damaging Het
Plin3 C A 17: 56,280,824 G297V probably benign Het
Podn C T 4: 108,018,909 V517I probably benign Het
Pomk T C 8: 25,983,316 D203G probably damaging Het
Ppil4 A G 10: 7,799,591 D168G probably damaging Het
Ptgr2 T C 12: 84,307,873 I276T probably benign Het
Ptk7 T A 17: 46,576,818 I563F possibly damaging Het
Rbm12 G T 2: 156,097,818 T178K unknown Het
Sctr T C 1: 120,031,673 probably null Het
Sh2b1 GGGACC GGGACCGGCTCAGCCACGTGGACC 7: 126,467,572 probably benign Het
Steap1 A T 5: 5,736,458 D326E probably damaging Het
Stra6 G A 9: 58,151,892 V513I probably benign Het
Tbx19 A G 1: 165,138,977 S443P unknown Het
Tcea3 T A 4: 136,264,574 C190S probably damaging Het
Tfr2 G A 5: 137,574,439 V171I probably benign Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem129 A G 5: 33,657,778 V17A probably benign Het
Tmem2 T A 19: 21,801,885 V353D probably damaging Het
Tmem87b T C 2: 128,818,433 L32P probably damaging Het
Tor1aip1 T A 1: 156,030,431 D205V probably damaging Het
Trim33 T C 3: 103,331,758 V684A probably benign Het
Triobp C T 15: 78,993,178 R1637C probably damaging Het
Uhrf1bp1 A G 17: 27,893,440 D1201G probably damaging Het
Ulbp1 C A 10: 7,456,371 M196I probably benign Het
Vash1 G A 12: 86,691,889 G370E probably damaging Het
Vmn2r23 A G 6: 123,712,713 T183A probably benign Het
Vta1 A G 10: 14,655,839 I264T probably benign Het
Zcchc8 A T 5: 123,700,570 M635K probably benign Het
Other mutations in Peg10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02029:Peg10 APN 6 4754473 utr 5 prime probably benign
IGL03063:Peg10 APN 6 4756647 utr 3 prime probably benign
piaggio UTSW 6 4756427 utr 3 prime probably benign
PIT4480001:Peg10 UTSW 6 4756560 missense unknown
R0090:Peg10 UTSW 6 4756063 utr 3 prime probably benign
R0148:Peg10 UTSW 6 4755711 missense possibly damaging 0.88
R0650:Peg10 UTSW 6 4756475 small insertion probably benign
R0698:Peg10 UTSW 6 4756835 utr 3 prime probably benign
R1600:Peg10 UTSW 6 4757080 utr 3 prime probably benign
R1842:Peg10 UTSW 6 4756381 utr 3 prime probably benign
R1930:Peg10 UTSW 6 4755778 missense probably damaging 0.99
R1931:Peg10 UTSW 6 4755778 missense probably damaging 0.99
R2162:Peg10 UTSW 6 4755914 utr 3 prime probably benign
R2215:Peg10 UTSW 6 4756918 utr 3 prime probably benign
R2339:Peg10 UTSW 6 4756102 utr 3 prime probably benign
R2847:Peg10 UTSW 6 4756912 utr 3 prime probably benign
R2848:Peg10 UTSW 6 4756912 utr 3 prime probably benign
R3000:Peg10 UTSW 6 4754276 utr 5 prime probably benign
R3056:Peg10 UTSW 6 4755029 missense possibly damaging 0.66
R4051:Peg10 UTSW 6 4754534 missense probably benign 0.00
R4059:Peg10 UTSW 6 4756427 utr 3 prime probably benign
R4296:Peg10 UTSW 6 4756472 small insertion probably benign
R4626:Peg10 UTSW 6 4756460 small insertion probably benign
R4634:Peg10 UTSW 6 4756452 small insertion probably benign
R4679:Peg10 UTSW 6 4756452 small insertion probably benign
R4834:Peg10 UTSW 6 4754294 utr 5 prime probably benign
R4982:Peg10 UTSW 6 4756451 small insertion probably benign
R4983:Peg10 UTSW 6 4756451 small insertion probably benign
R4996:Peg10 UTSW 6 4756454 small insertion probably benign
R4997:Peg10 UTSW 6 4756457 small insertion probably benign
R5015:Peg10 UTSW 6 4756453 small insertion probably benign
R5085:Peg10 UTSW 6 4755864 utr 3 prime probably benign
R5091:Peg10 UTSW 6 4754511 missense probably benign 0.01
R5231:Peg10 UTSW 6 4756939 utr 3 prime probably benign
R5278:Peg10 UTSW 6 4756442 small deletion probably benign
R5364:Peg10 UTSW 6 4756128 utr 3 prime probably benign
R5397:Peg10 UTSW 6 4756453 small insertion probably benign
R5485:Peg10 UTSW 6 4755565 missense probably benign 0.09
R5573:Peg10 UTSW 6 4755913 utr 3 prime probably benign
R5710:Peg10 UTSW 6 4756350 small insertion probably benign
R5710:Peg10 UTSW 6 4756351 small insertion probably benign
R5736:Peg10 UTSW 6 4754423 missense probably benign 0.00
R5865:Peg10 UTSW 6 4754375 missense probably damaging 0.98
R6056:Peg10 UTSW 6 4756449 small insertion probably benign
R6116:Peg10 UTSW 6 4756351 small insertion probably benign
R6129:Peg10 UTSW 6 4756449 small insertion probably benign
R6147:Peg10 UTSW 6 4754499 start gained probably benign
R6171:Peg10 UTSW 6 4756449 small insertion probably benign
R6194:Peg10 UTSW 6 4756351 small insertion probably benign
R6197:Peg10 UTSW 6 4756452 small insertion probably benign
R6207:Peg10 UTSW 6 4756449 small insertion probably benign
R6215:Peg10 UTSW 6 4756452 small insertion probably benign
R6276:Peg10 UTSW 6 4756449 small insertion probably benign
R6281:Peg10 UTSW 6 4756449 small insertion probably benign
R6287:Peg10 UTSW 6 4756451 small insertion probably benign
R6302:Peg10 UTSW 6 4756449 small insertion probably benign
R6393:Peg10 UTSW 6 4756452 small insertion probably benign
R6394:Peg10 UTSW 6 4756451 small insertion probably benign
R6405:Peg10 UTSW 6 4756453 small insertion probably benign
R6421:Peg10 UTSW 6 4756449 small insertion probably benign
R6486:Peg10 UTSW 6 4756449 small insertion probably benign
R6538:Peg10 UTSW 6 4756449 small insertion probably benign
R6668:Peg10 UTSW 6 4754502 missense probably benign 0.01
R6679:Peg10 UTSW 6 4754276 utr 5 prime probably benign
R6685:Peg10 UTSW 6 4754738 missense probably damaging 1.00
R6702:Peg10 UTSW 6 4756452 small insertion probably benign
R6706:Peg10 UTSW 6 4756452 small insertion probably benign
R6747:Peg10 UTSW 6 4757137 utr 3 prime probably benign
R6775:Peg10 UTSW 6 4756452 small insertion probably benign
R6811:Peg10 UTSW 6 4756451 small insertion probably benign
R6823:Peg10 UTSW 6 4756431 small deletion probably benign
R6826:Peg10 UTSW 6 4756353 small insertion probably benign
R6847:Peg10 UTSW 6 4754279 utr 5 prime probably benign
R6861:Peg10 UTSW 6 4756350 small insertion probably benign
R6861:Peg10 UTSW 6 4756351 small insertion probably benign
R6876:Peg10 UTSW 6 4756451 small insertion probably benign
R6891:Peg10 UTSW 6 4756449 small insertion probably benign
R6911:Peg10 UTSW 6 4756452 small insertion probably benign
R6973:Peg10 UTSW 6 4756431 small deletion probably benign
R6990:Peg10 UTSW 6 4756451 small insertion probably benign
R6998:Peg10 UTSW 6 4756398 small deletion probably benign
R7070:Peg10 UTSW 6 4756454 small insertion probably benign
R7120:Peg10 UTSW 6 4756398 small deletion probably benign
R7132:Peg10 UTSW 6 4756398 small deletion probably benign
R7140:Peg10 UTSW 6 4756452 small insertion probably benign
R7189:Peg10 UTSW 6 4756431 small deletion probably benign
R7208:Peg10 UTSW 6 4756398 small deletion probably benign
R7256:Peg10 UTSW 6 4756398 small deletion probably benign
R7260:Peg10 UTSW 6 4756398 small deletion probably benign
R7261:Peg10 UTSW 6 4756591 missense unknown
R7401:Peg10 UTSW 6 4756452 small insertion probably benign
R7409:Peg10 UTSW 6 4756398 small deletion probably benign
R7439:Peg10 UTSW 6 4756453 small insertion probably benign
R7475:Peg10 UTSW 6 4756398 small deletion probably benign
R7483:Peg10 UTSW 6 4756451 small insertion probably benign
R7502:Peg10 UTSW 6 4756398 small deletion probably benign
R7515:Peg10 UTSW 6 4756452 small insertion probably benign
R7520:Peg10 UTSW 6 4756796 missense unknown
R7544:Peg10 UTSW 6 4756427 frame shift probably null
R7571:Peg10 UTSW 6 4756082 missense unknown
R7581:Peg10 UTSW 6 4756452 small insertion probably benign
R7635:Peg10 UTSW 6 4754938 missense probably damaging 0.99
R7677:Peg10 UTSW 6 4756398 small deletion probably benign
R7697:Peg10 UTSW 6 4756453 small insertion probably benign
R7710:Peg10 UTSW 6 4756452 small insertion probably benign
R7803:Peg10 UTSW 6 4756431 small deletion probably benign
R7816:Peg10 UTSW 6 4756453 small insertion probably benign
R7820:Peg10 UTSW 6 4756398 small deletion probably benign
R7827:Peg10 UTSW 6 4756452 small insertion probably benign
R7861:Peg10 UTSW 6 4756431 small deletion probably benign
R7881:Peg10 UTSW 6 4756454 small insertion probably benign
R7904:Peg10 UTSW 6 4756452 small insertion probably benign
R7915:Peg10 UTSW 6 4756451 small insertion probably benign
R7916:Peg10 UTSW 6 4756451 small insertion probably benign
R7963:Peg10 UTSW 6 4756452 small insertion probably benign
R8016:Peg10 UTSW 6 4756451 small insertion probably benign
R8037:Peg10 UTSW 6 4756398 small deletion probably benign
R8062:Peg10 UTSW 6 4756398 small deletion probably benign
R8081:Peg10 UTSW 6 4756452 small insertion probably benign
R8113:Peg10 UTSW 6 4756451 small insertion probably benign
R8115:Peg10 UTSW 6 4756707 missense unknown
R8140:Peg10 UTSW 6 4756113 missense unknown
R8178:Peg10 UTSW 6 4756452 small insertion probably benign
R8233:Peg10 UTSW 6 4756453 small insertion probably benign
R8239:Peg10 UTSW 6 4756452 small insertion probably benign
R8281:Peg10 UTSW 6 4756431 small deletion probably benign
R8310:Peg10 UTSW 6 4756454 small insertion probably benign
R8312:Peg10 UTSW 6 4756452 small insertion probably benign
R8330:Peg10 UTSW 6 4756452 small insertion probably benign
R8338:Peg10 UTSW 6 4756398 small deletion probably benign
R8354:Peg10 UTSW 6 4756452 small insertion probably benign
R8387:Peg10 UTSW 6 4756452 small insertion probably benign
R8390:Peg10 UTSW 6 4756451 small insertion probably benign
R8408:Peg10 UTSW 6 4756453 small insertion probably benign
R8415:Peg10 UTSW 6 4756451 small insertion probably benign
R8439:Peg10 UTSW 6 4755462 missense possibly damaging 0.58
R8444:Peg10 UTSW 6 4756398 small deletion probably benign
R8463:Peg10 UTSW 6 4756453 small insertion probably benign
R8477:Peg10 UTSW 6 4756453 small insertion probably benign
R8507:Peg10 UTSW 6 4756453 small insertion probably benign
R8552:Peg10 UTSW 6 4756452 small insertion probably benign
R8678:Peg10 UTSW 6 4756431 small deletion probably benign
R8699:Peg10 UTSW 6 4756451 small insertion probably benign
R8700:Peg10 UTSW 6 4756451 small insertion probably benign
R8705:Peg10 UTSW 6 4756398 small deletion probably benign
R8765:Peg10 UTSW 6 4754492 missense unknown
R8824:Peg10 UTSW 6 4756451 small insertion probably benign
R8859:Peg10 UTSW 6 4756451 small insertion probably benign
R8870:Peg10 UTSW 6 4754825 missense probably damaging 0.99
R8909:Peg10 UTSW 6 4756451 small insertion probably benign
R8918:Peg10 UTSW 6 4756398 small deletion probably benign
R8924:Peg10 UTSW 6 4756398 small deletion probably benign
R8925:Peg10 UTSW 6 4756452 small insertion probably benign
R8930:Peg10 UTSW 6 4756449 small insertion probably benign
R8950:Peg10 UTSW 6 4756452 small insertion probably benign
R8960:Peg10 UTSW 6 4756449 small insertion probably benign
R8975:Peg10 UTSW 6 4756452 small insertion probably benign
R8988:Peg10 UTSW 6 4756398 small deletion probably benign
R9046:Peg10 UTSW 6 4756452 small insertion probably benign
R9068:Peg10 UTSW 6 4756451 small insertion probably benign
R9074:Peg10 UTSW 6 4756451 small insertion probably benign
R9088:Peg10 UTSW 6 4756453 small insertion probably benign
R9094:Peg10 UTSW 6 4756449 small insertion probably benign
R9114:Peg10 UTSW 6 4756452 small insertion probably benign
R9116:Peg10 UTSW 6 4756452 small insertion probably benign
R9135:Peg10 UTSW 6 4756453 small insertion probably benign
R9137:Peg10 UTSW 6 4756398 small deletion probably benign
R9139:Peg10 UTSW 6 4756449 small insertion probably benign
R9139:Peg10 UTSW 6 4757128 missense unknown
R9171:Peg10 UTSW 6 4756452 small insertion probably benign
R9173:Peg10 UTSW 6 4756451 small insertion probably benign
R9213:Peg10 UTSW 6 4756451 small insertion probably benign
R9216:Peg10 UTSW 6 4756452 small insertion probably benign
R9229:Peg10 UTSW 6 4756398 small deletion probably benign
R9233:Peg10 UTSW 6 4756398 small deletion probably benign
R9283:Peg10 UTSW 6 4756452 small insertion probably benign
R9328:Peg10 UTSW 6 4756398 small deletion probably benign
R9367:Peg10 UTSW 6 4756398 small deletion probably benign
R9369:Peg10 UTSW 6 4756452 small insertion probably benign
R9405:Peg10 UTSW 6 4756398 small deletion probably benign
R9410:Peg10 UTSW 6 4756452 small insertion probably benign
R9412:Peg10 UTSW 6 4756453 small insertion probably benign
R9421:Peg10 UTSW 6 4756398 small deletion probably benign
R9437:Peg10 UTSW 6 4756451 small insertion probably benign
R9440:Peg10 UTSW 6 4756451 small insertion probably benign
R9460:Peg10 UTSW 6 4756452 small insertion probably benign
R9492:Peg10 UTSW 6 4756398 small deletion probably benign
R9500:Peg10 UTSW 6 4756871 missense unknown
R9511:Peg10 UTSW 6 4756451 small insertion probably benign
R9515:Peg10 UTSW 6 4756452 small insertion probably benign
R9576:Peg10 UTSW 6 4756398 small deletion probably benign
R9610:Peg10 UTSW 6 4756452 small insertion probably benign
R9611:Peg10 UTSW 6 4756452 small insertion probably benign
R9611:Peg10 UTSW 6 4756453 small insertion probably benign
R9614:Peg10 UTSW 6 4756451 small insertion probably benign
R9619:Peg10 UTSW 6 4755316 missense probably benign 0.02
R9646:Peg10 UTSW 6 4756452 small insertion probably benign
R9655:Peg10 UTSW 6 4756398 small deletion probably benign
R9673:Peg10 UTSW 6 4756452 small insertion probably benign
R9675:Peg10 UTSW 6 4756398 small deletion probably benign
R9696:Peg10 UTSW 6 4756431 small deletion probably benign
R9749:Peg10 UTSW 6 4756398 small deletion probably benign
R9756:Peg10 UTSW 6 4756452 small insertion probably benign
X0065:Peg10 UTSW 6 4756515 utr 3 prime probably benign
Z1176:Peg10 UTSW 6 4756451 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGTTTACAGTGCCACAACCG -3'
(R):5'- ACCTTACAGGGTGGTAAATTCTG -3'

Sequencing Primer
(F):5'- TCAGCATGAGCATCTGCATG -3'
(R):5'- GGTGGTAAATTCTGAATCCAGCC -3'
Posted On 2022-07-18