Incidental Mutation 'R9495:Nlrp9b'
ID 717155
Institutional Source Beutler Lab
Gene Symbol Nlrp9b
Ensembl Gene ENSMUSG00000060508
Gene Name NLR family, pyrin domain containing 9B
Synonyms Nalp9b, Nalp-delta
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9495 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 19725318-19796867 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 19760462 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 624 (K624N)
Ref Sequence ENSEMBL: ENSMUSP00000072895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073151] [ENSMUST00000117909] [ENSMUST00000137183]
AlphaFold Q66X22
Predicted Effect possibly damaging
Transcript: ENSMUST00000073151
AA Change: K624N

PolyPhen 2 Score 0.642 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072895
Gene: ENSMUSG00000060508
AA Change: K624N

DomainStartEndE-ValueType
PYRIN 5 87 2.08e-23 SMART
Pfam:NACHT 143 311 4.3e-34 PFAM
low complexity region 580 595 N/A INTRINSIC
LRR 630 657 2.16e2 SMART
LRR 691 718 2.23e2 SMART
LRR 747 774 6.67e-2 SMART
LRR 776 803 3.65e0 SMART
LRR 804 831 5.59e-4 SMART
LRR 833 860 2.81e0 SMART
LRR 861 888 8.87e-7 SMART
LRR 890 917 9.24e1 SMART
Blast:LRR 918 945 2e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000117909
AA Change: K184N

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113762
Gene: ENSMUSG00000060508
AA Change: K184N

DomainStartEndE-ValueType
PYRIN 5 87 2.08e-23 SMART
Pfam:NACHT 143 179 2.8e-6 PFAM
LRR 190 217 2.16e2 SMART
LRR 251 278 2.23e2 SMART
LRR 307 334 6.67e-2 SMART
LRR 336 363 3.65e0 SMART
LRR 364 391 5.59e-4 SMART
LRR 393 420 2.81e0 SMART
Pfam:Chromo_shadow 450 501 2.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137183
SMART Domains Protein: ENSMUSP00000115158
Gene: ENSMUSG00000060508

DomainStartEndE-ValueType
PYRIN 5 87 2.08e-23 SMART
Pfam:NACHT 143 240 1.7e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NALP protein family. Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). This protein may play a regulatory role in the innate immune system as similar family members belong to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. [provided by RefSeq, Jul 2008]
PHENOTYPE: The protein protects against rotavirus infection. Homozygous KO leads to increased susceptibility to infection and greater severity of pathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T A 15: 79,019,842 (GRCm39) D158V probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
Aadacl2fm1 T C 3: 59,840,114 (GRCm39) I62T possibly damaging Het
Acp5 G A 9: 22,038,483 (GRCm39) Q273* probably null Het
Apoa5 G C 9: 46,181,944 (GRCm39) R340P probably damaging Het
Atp2b1 T A 10: 98,835,660 (GRCm39) N468K probably damaging Het
Bltp3a A G 17: 28,112,414 (GRCm39) D1201G probably damaging Het
Bphl A T 13: 34,234,312 (GRCm39) I143L probably benign Het
Cd33 A T 7: 43,182,150 (GRCm39) H98Q probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Cemip2 T A 19: 21,779,249 (GRCm39) V353D probably damaging Het
Cfap96 C T 8: 46,409,458 (GRCm39) S287N probably damaging Het
Colec10 A G 15: 54,325,761 (GRCm39) D197G probably damaging Het
Cpt1a T C 19: 3,433,795 (GRCm39) M759T probably benign Het
Ctc1 A G 11: 68,913,593 (GRCm39) Y165C probably damaging Het
Cyp2t4 G A 7: 26,854,717 (GRCm39) V66M possibly damaging Het
Dnah2 T C 11: 69,345,208 (GRCm39) D2667G possibly damaging Het
Dok1 T C 6: 83,009,972 (GRCm39) K46E probably damaging Het
Erv3 C A 2: 131,697,975 (GRCm39) W128L possibly damaging Het
Fam186a A G 15: 99,844,766 (GRCm39) S493P unknown Het
Fbn1 A T 2: 125,160,984 (GRCm39) N2185K probably damaging Het
Figla A C 6: 85,997,689 (GRCm39) H139P probably benign Het
Gemin4 A G 11: 76,101,749 (GRCm39) L1004P probably damaging Het
Gm11937 T C 11: 99,500,646 (GRCm39) T124A unknown Het
Gm17669 G T 18: 67,695,682 (GRCm39) V76L probably benign Het
H2ac21 A G 3: 96,127,401 (GRCm39) E57G probably damaging Het
Hcls1 A T 16: 36,777,702 (GRCm39) M274L probably benign Het
Il17rc T C 6: 113,449,741 (GRCm39) S116P probably damaging Het
Krt79 G A 15: 101,840,288 (GRCm39) R303C probably damaging Het
Lamb2 C T 9: 108,358,006 (GRCm39) T149I probably damaging Het
Lrrc41 T A 4: 115,932,806 (GRCm39) probably null Het
Mga C A 2: 119,781,676 (GRCm39) T2234K possibly damaging Het
Mix23 A G 16: 35,892,491 (GRCm39) E12G probably benign Het
Muc6 T A 7: 141,237,398 (GRCm39) Q205L probably damaging Het
Or1o4 G T 17: 37,591,386 (GRCm39) probably benign Het
Or4d2 C T 11: 87,784,082 (GRCm39) V223M probably benign Het
Or6e1 T C 14: 54,520,137 (GRCm39) T72A probably damaging Het
Otud4 T C 8: 80,400,087 (GRCm39) S934P probably damaging Het
Pcdha12 G T 18: 37,155,526 (GRCm39) W748C probably damaging Het
Pdc T C 1: 150,208,919 (GRCm39) I134T probably damaging Het
Peg10 T TCCC 6: 4,756,451 (GRCm39) probably benign Het
Pkn1 C T 8: 84,410,799 (GRCm39) R276Q possibly damaging Het
Plin3 C A 17: 56,587,824 (GRCm39) G297V probably benign Het
Podn C T 4: 107,876,106 (GRCm39) V517I probably benign Het
Pomk T C 8: 26,473,344 (GRCm39) D203G probably damaging Het
Ppil4 A G 10: 7,675,355 (GRCm39) D168G probably damaging Het
Ptgr2 T C 12: 84,354,647 (GRCm39) I276T probably benign Het
Ptk7 T A 17: 46,887,744 (GRCm39) I563F possibly damaging Het
Rbm12 G T 2: 155,939,738 (GRCm39) T178K unknown Het
Sctr T C 1: 119,959,403 (GRCm39) probably null Het
Sh2b1 GGGACC GGGACCGGCTCAGCCACGTGGACC 7: 126,066,744 (GRCm39) probably benign Het
Spata31e4 T A 13: 50,855,465 (GRCm39) S368T possibly damaging Het
Steap1 A T 5: 5,786,458 (GRCm39) D326E probably damaging Het
Stra6 G A 9: 58,059,175 (GRCm39) V513I probably benign Het
Tbx19 A G 1: 164,966,546 (GRCm39) S443P unknown Het
Tcea3 T A 4: 135,991,885 (GRCm39) C190S probably damaging Het
Tfr2 G A 5: 137,572,701 (GRCm39) V171I probably benign Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tmem129 A G 5: 33,815,122 (GRCm39) V17A probably benign Het
Tmem87b T C 2: 128,660,353 (GRCm39) L32P probably damaging Het
Tor1aip1 T A 1: 155,906,177 (GRCm39) D205V probably damaging Het
Trim33 T C 3: 103,239,074 (GRCm39) V684A probably benign Het
Triobp C T 15: 78,877,378 (GRCm39) R1637C probably damaging Het
Ulbp1 C A 10: 7,406,371 (GRCm39) M196I probably benign Het
Vash1 G A 12: 86,738,663 (GRCm39) G370E probably damaging Het
Vmn2r23 A G 6: 123,689,672 (GRCm39) T183A probably benign Het
Vta1 A G 10: 14,531,583 (GRCm39) I264T probably benign Het
Zcchc8 A T 5: 123,838,633 (GRCm39) M635K probably benign Het
Other mutations in Nlrp9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Nlrp9b APN 7 19,757,203 (GRCm39) missense probably benign 0.43
IGL00675:Nlrp9b APN 7 19,757,111 (GRCm39) missense possibly damaging 0.63
IGL00755:Nlrp9b APN 7 19,757,447 (GRCm39) missense probably damaging 1.00
IGL01131:Nlrp9b APN 7 19,757,462 (GRCm39) missense probably damaging 1.00
IGL01134:Nlrp9b APN 7 19,757,112 (GRCm39) missense probably benign 0.06
IGL01464:Nlrp9b APN 7 19,796,580 (GRCm39) missense probably benign 0.00
IGL01514:Nlrp9b APN 7 19,779,859 (GRCm39) critical splice donor site probably null
IGL01731:Nlrp9b APN 7 19,757,342 (GRCm39) nonsense probably null
IGL02427:Nlrp9b APN 7 19,776,426 (GRCm39) missense probably damaging 1.00
IGL03013:Nlrp9b APN 7 19,782,750 (GRCm39) missense probably damaging 1.00
R0037:Nlrp9b UTSW 7 19,757,647 (GRCm39) missense probably damaging 0.99
R0114:Nlrp9b UTSW 7 19,757,981 (GRCm39) missense probably benign 0.00
R0276:Nlrp9b UTSW 7 19,762,423 (GRCm39) missense probably benign 0.21
R0346:Nlrp9b UTSW 7 19,758,440 (GRCm39) missense probably damaging 0.99
R0736:Nlrp9b UTSW 7 19,783,375 (GRCm39) missense probably damaging 1.00
R1449:Nlrp9b UTSW 7 19,757,089 (GRCm39) missense possibly damaging 0.91
R1540:Nlrp9b UTSW 7 19,782,772 (GRCm39) nonsense probably null
R1648:Nlrp9b UTSW 7 19,760,469 (GRCm39) missense possibly damaging 0.89
R1878:Nlrp9b UTSW 7 19,762,489 (GRCm39) missense probably benign 0.01
R1903:Nlrp9b UTSW 7 19,757,182 (GRCm39) missense probably benign 0.44
R2191:Nlrp9b UTSW 7 19,757,587 (GRCm39) missense probably benign
R4572:Nlrp9b UTSW 7 19,760,606 (GRCm39) critical splice donor site probably null
R4863:Nlrp9b UTSW 7 19,783,521 (GRCm39) critical splice donor site probably null
R4939:Nlrp9b UTSW 7 19,758,421 (GRCm39) missense probably damaging 0.99
R5211:Nlrp9b UTSW 7 19,783,381 (GRCm39) missense probably damaging 1.00
R5329:Nlrp9b UTSW 7 19,757,916 (GRCm39) missense probably damaging 1.00
R5580:Nlrp9b UTSW 7 19,757,089 (GRCm39) missense probably damaging 0.98
R5696:Nlrp9b UTSW 7 19,758,417 (GRCm39) missense probably benign 0.02
R6265:Nlrp9b UTSW 7 19,796,608 (GRCm39) missense probably benign
R6456:Nlrp9b UTSW 7 19,782,703 (GRCm39) missense probably damaging 1.00
R6672:Nlrp9b UTSW 7 19,753,263 (GRCm39) missense probably damaging 1.00
R6750:Nlrp9b UTSW 7 19,757,159 (GRCm39) nonsense probably null
R6896:Nlrp9b UTSW 7 19,757,170 (GRCm39) missense probably damaging 0.96
R6968:Nlrp9b UTSW 7 19,783,433 (GRCm39) missense probably damaging 1.00
R7108:Nlrp9b UTSW 7 19,779,855 (GRCm39) missense probably damaging 1.00
R7287:Nlrp9b UTSW 7 19,762,381 (GRCm39) missense probably damaging 0.97
R7297:Nlrp9b UTSW 7 19,783,438 (GRCm39) missense possibly damaging 0.81
R7485:Nlrp9b UTSW 7 19,757,875 (GRCm39) missense probably damaging 1.00
R7552:Nlrp9b UTSW 7 19,779,691 (GRCm39) missense probably benign 0.04
R7573:Nlrp9b UTSW 7 19,753,125 (GRCm39) missense probably damaging 1.00
R7690:Nlrp9b UTSW 7 19,758,295 (GRCm39) missense probably benign 0.00
R7839:Nlrp9b UTSW 7 19,758,398 (GRCm39) missense possibly damaging 0.49
R7913:Nlrp9b UTSW 7 19,779,725 (GRCm39) missense probably benign 0.07
R7968:Nlrp9b UTSW 7 19,762,493 (GRCm39) missense probably benign 0.01
R8113:Nlrp9b UTSW 7 19,753,260 (GRCm39) missense probably benign 0.02
R8273:Nlrp9b UTSW 7 19,757,986 (GRCm39) missense possibly damaging 0.89
R8400:Nlrp9b UTSW 7 19,757,937 (GRCm39) nonsense probably null
R9047:Nlrp9b UTSW 7 19,757,401 (GRCm39) missense possibly damaging 0.80
R9224:Nlrp9b UTSW 7 19,757,476 (GRCm39) missense probably benign 0.44
R9224:Nlrp9b UTSW 7 19,753,217 (GRCm39) missense probably benign 0.00
R9291:Nlrp9b UTSW 7 19,758,511 (GRCm39) missense possibly damaging 0.80
R9348:Nlrp9b UTSW 7 19,757,336 (GRCm39) missense probably damaging 1.00
R9398:Nlrp9b UTSW 7 19,783,435 (GRCm39) missense probably damaging 1.00
R9442:Nlrp9b UTSW 7 19,779,707 (GRCm39) missense possibly damaging 0.84
R9598:Nlrp9b UTSW 7 19,753,302 (GRCm39) missense probably benign 0.17
R9757:Nlrp9b UTSW 7 19,782,617 (GRCm39) missense probably damaging 1.00
X0064:Nlrp9b UTSW 7 19,782,683 (GRCm39) missense probably damaging 1.00
Z1088:Nlrp9b UTSW 7 19,757,668 (GRCm39) missense probably benign 0.01
Z1177:Nlrp9b UTSW 7 19,760,571 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCATTTTGTATTCCACAGTGC -3'
(R):5'- CTGCTGTCTACTTAAATGATGGG -3'

Sequencing Primer
(F):5'- AGCTTCCACATGGATTCTGGGAATC -3'
(R):5'- GATGGGAGACTATTAAACTTACGAC -3'
Posted On 2022-07-18