Incidental Mutation 'R9495:Nlrp9b'
ID 717155
Institutional Source Beutler Lab
Gene Symbol Nlrp9b
Ensembl Gene ENSMUSG00000060508
Gene Name NLR family, pyrin domain containing 9B
Synonyms Nalp-delta, Nalp9b
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9495 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 19991465-20073306 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20026537 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 624 (K624N)
Ref Sequence ENSEMBL: ENSMUSP00000072895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073151] [ENSMUST00000117909] [ENSMUST00000137183]
AlphaFold Q66X22
Predicted Effect possibly damaging
Transcript: ENSMUST00000073151
AA Change: K624N

PolyPhen 2 Score 0.642 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072895
Gene: ENSMUSG00000060508
AA Change: K624N

DomainStartEndE-ValueType
PYRIN 5 87 2.08e-23 SMART
Pfam:NACHT 143 311 4.3e-34 PFAM
low complexity region 580 595 N/A INTRINSIC
LRR 630 657 2.16e2 SMART
LRR 691 718 2.23e2 SMART
LRR 747 774 6.67e-2 SMART
LRR 776 803 3.65e0 SMART
LRR 804 831 5.59e-4 SMART
LRR 833 860 2.81e0 SMART
LRR 861 888 8.87e-7 SMART
LRR 890 917 9.24e1 SMART
Blast:LRR 918 945 2e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000117909
AA Change: K184N

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113762
Gene: ENSMUSG00000060508
AA Change: K184N

DomainStartEndE-ValueType
PYRIN 5 87 2.08e-23 SMART
Pfam:NACHT 143 179 2.8e-6 PFAM
LRR 190 217 2.16e2 SMART
LRR 251 278 2.23e2 SMART
LRR 307 334 6.67e-2 SMART
LRR 336 363 3.65e0 SMART
LRR 364 391 5.59e-4 SMART
LRR 393 420 2.81e0 SMART
Pfam:Chromo_shadow 450 501 2.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137183
SMART Domains Protein: ENSMUSP00000115158
Gene: ENSMUSG00000060508

DomainStartEndE-ValueType
PYRIN 5 87 2.08e-23 SMART
Pfam:NACHT 143 240 1.7e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NALP protein family. Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). This protein may play a regulatory role in the innate immune system as similar family members belong to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. [provided by RefSeq, Jul 2008]
PHENOTYPE: The protein protects against rotavirus infection. Homozygous KO leads to increased susceptibility to infection and greater severity of pathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik C T 8: 45,956,421 S287N probably damaging Het
1700088E04Rik T A 15: 79,135,642 D158V probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Acp5 G A 9: 22,127,187 Q273* probably null Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Atp2b1 T A 10: 98,999,798 N468K probably damaging Het
Bphl A T 13: 34,050,329 I143L probably benign Het
C130079G13Rik T C 3: 59,932,693 I62T possibly damaging Het
Ccdc58 A G 16: 36,072,121 E12G probably benign Het
Cd33 A T 7: 43,532,726 H98Q probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Colec10 A G 15: 54,462,365 D197G probably damaging Het
Cpt1a T C 19: 3,383,795 M759T probably benign Het
Ctc1 A G 11: 69,022,767 Y165C probably damaging Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Dnah2 T C 11: 69,454,382 D2667G possibly damaging Het
Dok1 T C 6: 83,032,991 K46E probably damaging Het
Erv3 C A 2: 131,856,055 W128L possibly damaging Het
Fam186a A G 15: 99,946,885 S493P unknown Het
Fbn1 A T 2: 125,319,064 N2185K probably damaging Het
Figla A C 6: 86,020,707 H139P probably benign Het
Gemin4 A G 11: 76,210,923 L1004P probably damaging Het
Gm11937 T C 11: 99,609,820 T124A unknown Het
Gm17669 G T 18: 67,562,612 V76L probably benign Het
Gm8765 T A 13: 50,701,429 S368T possibly damaging Het
Hcls1 A T 16: 36,957,340 M274L probably benign Het
Hist2h2ab A G 3: 96,220,085 E57G probably damaging Het
Il17rc T C 6: 113,472,780 S116P probably damaging Het
Krt79 G A 15: 101,931,853 R303C probably damaging Het
Lamb2 C T 9: 108,480,807 T149I probably damaging Het
Lrrc41 T A 4: 116,075,609 probably null Het
Mga C A 2: 119,951,195 T2234K possibly damaging Het
Muc6 T A 7: 141,651,133 Q205L probably damaging Het
Olfr463 C T 11: 87,893,256 V223M probably benign Het
Olfr49 T C 14: 54,282,680 T72A probably damaging Het
Olfr99 G T 17: 37,280,495 probably benign Het
Otud4 T C 8: 79,673,458 S934P probably damaging Het
Pcdha12 G T 18: 37,022,473 W748C probably damaging Het
Pdc T C 1: 150,333,168 I134T probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Pkn1 C T 8: 83,684,170 R276Q possibly damaging Het
Plin3 C A 17: 56,280,824 G297V probably benign Het
Podn C T 4: 108,018,909 V517I probably benign Het
Pomk T C 8: 25,983,316 D203G probably damaging Het
Ppil4 A G 10: 7,799,591 D168G probably damaging Het
Ptgr2 T C 12: 84,307,873 I276T probably benign Het
Ptk7 T A 17: 46,576,818 I563F possibly damaging Het
Rbm12 G T 2: 156,097,818 T178K unknown Het
Sctr T C 1: 120,031,673 probably null Het
Sh2b1 GGGACC GGGACCGGCTCAGCCACGTGGACC 7: 126,467,572 probably benign Het
Steap1 A T 5: 5,736,458 D326E probably damaging Het
Stra6 G A 9: 58,151,892 V513I probably benign Het
Tbx19 A G 1: 165,138,977 S443P unknown Het
Tcea3 T A 4: 136,264,574 C190S probably damaging Het
Tfr2 G A 5: 137,574,439 V171I probably benign Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem129 A G 5: 33,657,778 V17A probably benign Het
Tmem2 T A 19: 21,801,885 V353D probably damaging Het
Tmem87b T C 2: 128,818,433 L32P probably damaging Het
Tor1aip1 T A 1: 156,030,431 D205V probably damaging Het
Trim33 T C 3: 103,331,758 V684A probably benign Het
Triobp C T 15: 78,993,178 R1637C probably damaging Het
Uhrf1bp1 A G 17: 27,893,440 D1201G probably damaging Het
Ulbp1 C A 10: 7,456,371 M196I probably benign Het
Vash1 G A 12: 86,691,889 G370E probably damaging Het
Vmn2r23 A G 6: 123,712,713 T183A probably benign Het
Vta1 A G 10: 14,655,839 I264T probably benign Het
Zcchc8 A T 5: 123,700,570 M635K probably benign Het
Other mutations in Nlrp9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Nlrp9b APN 7 20023278 missense probably benign 0.43
IGL00675:Nlrp9b APN 7 20023186 missense possibly damaging 0.63
IGL00755:Nlrp9b APN 7 20023522 missense probably damaging 1.00
IGL01131:Nlrp9b APN 7 20023537 missense probably damaging 1.00
IGL01134:Nlrp9b APN 7 20023187 missense probably benign 0.06
IGL01464:Nlrp9b APN 7 20062655 missense probably benign 0.00
IGL01514:Nlrp9b APN 7 20045934 critical splice donor site probably null
IGL01731:Nlrp9b APN 7 20023417 nonsense probably null
IGL02427:Nlrp9b APN 7 20042501 missense probably damaging 1.00
IGL03013:Nlrp9b APN 7 20048825 missense probably damaging 1.00
R0037:Nlrp9b UTSW 7 20023722 missense probably damaging 0.99
R0114:Nlrp9b UTSW 7 20024056 missense probably benign 0.00
R0276:Nlrp9b UTSW 7 20028498 missense probably benign 0.21
R0346:Nlrp9b UTSW 7 20024515 missense probably damaging 0.99
R0736:Nlrp9b UTSW 7 20049450 missense probably damaging 1.00
R1449:Nlrp9b UTSW 7 20023164 missense possibly damaging 0.91
R1540:Nlrp9b UTSW 7 20048847 nonsense probably null
R1648:Nlrp9b UTSW 7 20026544 missense possibly damaging 0.89
R1878:Nlrp9b UTSW 7 20028564 missense probably benign 0.01
R1903:Nlrp9b UTSW 7 20023257 missense probably benign 0.44
R2191:Nlrp9b UTSW 7 20023662 missense probably benign
R4572:Nlrp9b UTSW 7 20026681 critical splice donor site probably null
R4863:Nlrp9b UTSW 7 20049596 critical splice donor site probably null
R4939:Nlrp9b UTSW 7 20024496 missense probably damaging 0.99
R5211:Nlrp9b UTSW 7 20049456 missense probably damaging 1.00
R5329:Nlrp9b UTSW 7 20023991 missense probably damaging 1.00
R5580:Nlrp9b UTSW 7 20023164 missense probably damaging 0.98
R5696:Nlrp9b UTSW 7 20024492 missense probably benign 0.02
R6265:Nlrp9b UTSW 7 20062683 missense probably benign
R6456:Nlrp9b UTSW 7 20048778 missense probably damaging 1.00
R6672:Nlrp9b UTSW 7 20019338 missense probably damaging 1.00
R6750:Nlrp9b UTSW 7 20023234 nonsense probably null
R6896:Nlrp9b UTSW 7 20023245 missense probably damaging 0.96
R6968:Nlrp9b UTSW 7 20049508 missense probably damaging 1.00
R7108:Nlrp9b UTSW 7 20045930 missense probably damaging 1.00
R7287:Nlrp9b UTSW 7 20028456 missense probably damaging 0.97
R7297:Nlrp9b UTSW 7 20049513 missense possibly damaging 0.81
R7485:Nlrp9b UTSW 7 20023950 missense probably damaging 1.00
R7552:Nlrp9b UTSW 7 20045766 missense probably benign 0.04
R7573:Nlrp9b UTSW 7 20019200 missense probably damaging 1.00
R7690:Nlrp9b UTSW 7 20024370 missense probably benign 0.00
R7839:Nlrp9b UTSW 7 20024473 missense possibly damaging 0.49
R7913:Nlrp9b UTSW 7 20045800 missense probably benign 0.07
R7968:Nlrp9b UTSW 7 20028568 missense probably benign 0.01
R8113:Nlrp9b UTSW 7 20019335 missense probably benign 0.02
R8273:Nlrp9b UTSW 7 20024061 missense possibly damaging 0.89
R8400:Nlrp9b UTSW 7 20024012 nonsense probably null
R9047:Nlrp9b UTSW 7 20023476 missense possibly damaging 0.80
R9224:Nlrp9b UTSW 7 20019292 missense probably benign 0.00
R9224:Nlrp9b UTSW 7 20023551 missense probably benign 0.44
R9291:Nlrp9b UTSW 7 20024586 missense possibly damaging 0.80
R9348:Nlrp9b UTSW 7 20023411 missense probably damaging 1.00
R9398:Nlrp9b UTSW 7 20049510 missense probably damaging 1.00
R9442:Nlrp9b UTSW 7 20045782 missense possibly damaging 0.84
R9598:Nlrp9b UTSW 7 20019377 missense probably benign 0.17
R9757:Nlrp9b UTSW 7 20048692 missense probably damaging 1.00
X0064:Nlrp9b UTSW 7 20048758 missense probably damaging 1.00
Z1088:Nlrp9b UTSW 7 20023743 missense probably benign 0.01
Z1177:Nlrp9b UTSW 7 20026646 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCATTTTGTATTCCACAGTGC -3'
(R):5'- CTGCTGTCTACTTAAATGATGGG -3'

Sequencing Primer
(F):5'- AGCTTCCACATGGATTCTGGGAATC -3'
(R):5'- GATGGGAGACTATTAAACTTACGAC -3'
Posted On 2022-07-18