Incidental Mutation 'R9495:Cd33'
ID 717158
Institutional Source Beutler Lab
Gene Symbol Cd33
Ensembl Gene ENSMUSG00000004609
Gene Name CD33 antigen
Synonyms Siglec-3, gp67
Accession Numbers

Genbank: NM_001111058.1, NM_021293.3; Ensembl: ENSMUST00000004728, ENSMUST00000039861

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9495 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 43524216-43544428 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43532726 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 98 (H98Q)
Ref Sequence ENSEMBL: ENSMUSP00000004728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004728] [ENSMUST00000039861] [ENSMUST00000205503]
AlphaFold Q63994
Predicted Effect probably benign
Transcript: ENSMUST00000004728
AA Change: H98Q

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000004728
Gene: ENSMUSG00000004609
AA Change: H98Q

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 26 139 2.58e-6 SMART
IG_like 148 232 2.66e1 SMART
transmembrane domain 242 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039861
AA Change: H98Q

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000045458
Gene: ENSMUSG00000004609
AA Change: H98Q

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 26 139 2.58e-6 SMART
IG_like 148 232 2.66e1 SMART
transmembrane domain 242 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205503
AA Change: H98Q

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000206371
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene show slight reductions in mean erythrocyte count and hematocrit and increased concentration of blood aspartate aminotransaminase. There is also a hyporesponsiveness to induced peritonitis and a weaker IL-6 response to LPS-induced systemic inflammation. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik C T 8: 45,956,421 S287N probably damaging Het
1700088E04Rik T A 15: 79,135,642 D158V probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Acp5 G A 9: 22,127,187 Q273* probably null Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Atp2b1 T A 10: 98,999,798 N468K probably damaging Het
Bphl A T 13: 34,050,329 I143L probably benign Het
C130079G13Rik T C 3: 59,932,693 I62T possibly damaging Het
Ccdc58 A G 16: 36,072,121 E12G probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Colec10 A G 15: 54,462,365 D197G probably damaging Het
Cpt1a T C 19: 3,383,795 M759T probably benign Het
Ctc1 A G 11: 69,022,767 Y165C probably damaging Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Dnah2 T C 11: 69,454,382 D2667G possibly damaging Het
Dok1 T C 6: 83,032,991 K46E probably damaging Het
Erv3 C A 2: 131,856,055 W128L possibly damaging Het
Fam186a A G 15: 99,946,885 S493P unknown Het
Fbn1 A T 2: 125,319,064 N2185K probably damaging Het
Figla A C 6: 86,020,707 H139P probably benign Het
Gemin4 A G 11: 76,210,923 L1004P probably damaging Het
Gm11937 T C 11: 99,609,820 T124A unknown Het
Gm17669 G T 18: 67,562,612 V76L probably benign Het
Gm8765 T A 13: 50,701,429 S368T possibly damaging Het
Hcls1 A T 16: 36,957,340 M274L probably benign Het
Hist2h2ab A G 3: 96,220,085 E57G probably damaging Het
Il17rc T C 6: 113,472,780 S116P probably damaging Het
Krt79 G A 15: 101,931,853 R303C probably damaging Het
Lamb2 C T 9: 108,480,807 T149I probably damaging Het
Lrrc41 T A 4: 116,075,609 probably null Het
Mga C A 2: 119,951,195 T2234K possibly damaging Het
Muc6 T A 7: 141,651,133 Q205L probably damaging Het
Nlrp9b A T 7: 20,026,537 K624N possibly damaging Het
Olfr463 C T 11: 87,893,256 V223M probably benign Het
Olfr49 T C 14: 54,282,680 T72A probably damaging Het
Olfr99 G T 17: 37,280,495 probably benign Het
Otud4 T C 8: 79,673,458 S934P probably damaging Het
Pcdha12 G T 18: 37,022,473 W748C probably damaging Het
Pdc T C 1: 150,333,168 I134T probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Pkn1 C T 8: 83,684,170 R276Q possibly damaging Het
Plin3 C A 17: 56,280,824 G297V probably benign Het
Podn C T 4: 108,018,909 V517I probably benign Het
Pomk T C 8: 25,983,316 D203G probably damaging Het
Ppil4 A G 10: 7,799,591 D168G probably damaging Het
Ptgr2 T C 12: 84,307,873 I276T probably benign Het
Ptk7 T A 17: 46,576,818 I563F possibly damaging Het
Rbm12 G T 2: 156,097,818 T178K unknown Het
Sctr T C 1: 120,031,673 probably null Het
Sh2b1 GGGACC GGGACCGGCTCAGCCACGTGGACC 7: 126,467,572 probably benign Het
Steap1 A T 5: 5,736,458 D326E probably damaging Het
Stra6 G A 9: 58,151,892 V513I probably benign Het
Tbx19 A G 1: 165,138,977 S443P unknown Het
Tcea3 T A 4: 136,264,574 C190S probably damaging Het
Tfr2 G A 5: 137,574,439 V171I probably benign Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem129 A G 5: 33,657,778 V17A probably benign Het
Tmem2 T A 19: 21,801,885 V353D probably damaging Het
Tmem87b T C 2: 128,818,433 L32P probably damaging Het
Tor1aip1 T A 1: 156,030,431 D205V probably damaging Het
Trim33 T C 3: 103,331,758 V684A probably benign Het
Triobp C T 15: 78,993,178 R1637C probably damaging Het
Uhrf1bp1 A G 17: 27,893,440 D1201G probably damaging Het
Ulbp1 C A 10: 7,456,371 M196I probably benign Het
Vash1 G A 12: 86,691,889 G370E probably damaging Het
Vmn2r23 A G 6: 123,712,713 T183A probably benign Het
Vta1 A G 10: 14,655,839 I264T probably benign Het
Zcchc8 A T 5: 123,700,570 M635K probably benign Het
Other mutations in Cd33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Cd33 APN 7 43529558 intron probably benign
IGL01025:Cd33 APN 7 43532905 missense probably damaging 1.00
IGL01593:Cd33 APN 7 43530281 missense possibly damaging 0.91
IGL02080:Cd33 APN 7 43528850 utr 3 prime probably benign
IGL02519:Cd33 APN 7 43528729 utr 3 prime probably benign
IGL02626:Cd33 APN 7 43530312 splice site probably benign
1mM(1):Cd33 UTSW 7 43528793 utr 3 prime probably benign
R0751:Cd33 UTSW 7 43532121 missense probably damaging 1.00
R1513:Cd33 UTSW 7 43532194 missense probably damaging 1.00
R1542:Cd33 UTSW 7 43532106 missense probably damaging 1.00
R1752:Cd33 UTSW 7 43532298 missense probably benign 0.24
R1928:Cd33 UTSW 7 43529879 missense probably benign 0.41
R2045:Cd33 UTSW 7 43529892 missense probably benign 0.00
R2127:Cd33 UTSW 7 43530275 missense possibly damaging 0.72
R3433:Cd33 UTSW 7 43529907 missense probably benign 0.00
R4760:Cd33 UTSW 7 43529495 missense probably benign
R4810:Cd33 UTSW 7 43532710 missense probably damaging 0.99
R5387:Cd33 UTSW 7 43532053 nonsense probably null
R5611:Cd33 UTSW 7 43532118 missense probably damaging 0.97
R5796:Cd33 UTSW 7 43533056 critical splice donor site probably null
R8021:Cd33 UTSW 7 43528838 missense unknown
R8193:Cd33 UTSW 7 43532272 missense possibly damaging 0.96
R8993:Cd33 UTSW 7 43533447 unclassified probably benign
R9514:Cd33 UTSW 7 43532726 missense probably benign 0.09
R9590:Cd33 UTSW 7 43530213 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAGGATGAGGTACAAGTCTTCC -3'
(R):5'- ATGTGCCCTGCAGTGTTTTC -3'

Sequencing Primer
(F):5'- GGATGAGGTACAAGTCTTCCAACAC -3'
(R):5'- GCAGTGTTTTCTACCCCTCCATTAAG -3'
Posted On 2022-07-18