Incidental Mutation 'R9495:Otud4'
ID 717163
Institutional Source Beutler Lab
Gene Symbol Otud4
Ensembl Gene ENSMUSG00000036990
Gene Name OTU domain containing 4
Synonyms 4930431L18Rik, D8Ertd69e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock # R9495 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 79639618-79677724 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79673458 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 934 (S934P)
Ref Sequence ENSEMBL: ENSMUSP00000133939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173078] [ENSMUST00000173286]
AlphaFold B2RRE7
Predicted Effect probably damaging
Transcript: ENSMUST00000173078
AA Change: S934P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133939
Gene: ENSMUSG00000036990
AA Change: S934P

DomainStartEndE-ValueType
Pfam:OTU 40 154 3.4e-17 PFAM
low complexity region 189 213 N/A INTRINSIC
Blast:TUDOR 280 335 2e-7 BLAST
low complexity region 392 405 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 543 555 N/A INTRINSIC
low complexity region 1014 1025 N/A INTRINSIC
low complexity region 1082 1104 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173286
AA Change: S933P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134097
Gene: ENSMUSG00000036990
AA Change: S933P

DomainStartEndE-ValueType
Pfam:OTU 40 149 5.3e-21 PFAM
low complexity region 189 213 N/A INTRINSIC
Blast:TUDOR 280 334 9e-9 BLAST
low complexity region 391 404 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
low complexity region 542 554 N/A INTRINSIC
low complexity region 1013 1024 N/A INTRINSIC
low complexity region 1081 1103 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alternatively spliced transcript variants have been found for this gene. The smaller protein isoform encoded by the shorter transcript variant is found only in HIV-1 infected cells. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik C T 8: 45,956,421 S287N probably damaging Het
1700088E04Rik T A 15: 79,135,642 D158V probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Acp5 G A 9: 22,127,187 Q273* probably null Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Atp2b1 T A 10: 98,999,798 N468K probably damaging Het
Bphl A T 13: 34,050,329 I143L probably benign Het
C130079G13Rik T C 3: 59,932,693 I62T possibly damaging Het
Ccdc58 A G 16: 36,072,121 E12G probably benign Het
Cd33 A T 7: 43,532,726 H98Q probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Colec10 A G 15: 54,462,365 D197G probably damaging Het
Cpt1a T C 19: 3,383,795 M759T probably benign Het
Ctc1 A G 11: 69,022,767 Y165C probably damaging Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Dnah2 T C 11: 69,454,382 D2667G possibly damaging Het
Dok1 T C 6: 83,032,991 K46E probably damaging Het
Erv3 C A 2: 131,856,055 W128L possibly damaging Het
Fam186a A G 15: 99,946,885 S493P unknown Het
Fbn1 A T 2: 125,319,064 N2185K probably damaging Het
Figla A C 6: 86,020,707 H139P probably benign Het
Gemin4 A G 11: 76,210,923 L1004P probably damaging Het
Gm11937 T C 11: 99,609,820 T124A unknown Het
Gm17669 G T 18: 67,562,612 V76L probably benign Het
Gm8765 T A 13: 50,701,429 S368T possibly damaging Het
Hcls1 A T 16: 36,957,340 M274L probably benign Het
Hist2h2ab A G 3: 96,220,085 E57G probably damaging Het
Il17rc T C 6: 113,472,780 S116P probably damaging Het
Krt79 G A 15: 101,931,853 R303C probably damaging Het
Lamb2 C T 9: 108,480,807 T149I probably damaging Het
Lrrc41 T A 4: 116,075,609 probably null Het
Mga C A 2: 119,951,195 T2234K possibly damaging Het
Muc6 T A 7: 141,651,133 Q205L probably damaging Het
Nlrp9b A T 7: 20,026,537 K624N possibly damaging Het
Olfr463 C T 11: 87,893,256 V223M probably benign Het
Olfr49 T C 14: 54,282,680 T72A probably damaging Het
Olfr99 G T 17: 37,280,495 probably benign Het
Pcdha12 G T 18: 37,022,473 W748C probably damaging Het
Pdc T C 1: 150,333,168 I134T probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Pkn1 C T 8: 83,684,170 R276Q possibly damaging Het
Plin3 C A 17: 56,280,824 G297V probably benign Het
Podn C T 4: 108,018,909 V517I probably benign Het
Pomk T C 8: 25,983,316 D203G probably damaging Het
Ppil4 A G 10: 7,799,591 D168G probably damaging Het
Ptgr2 T C 12: 84,307,873 I276T probably benign Het
Ptk7 T A 17: 46,576,818 I563F possibly damaging Het
Rbm12 G T 2: 156,097,818 T178K unknown Het
Sctr T C 1: 120,031,673 probably null Het
Sh2b1 GGGACC GGGACCGGCTCAGCCACGTGGACC 7: 126,467,572 probably benign Het
Steap1 A T 5: 5,736,458 D326E probably damaging Het
Stra6 G A 9: 58,151,892 V513I probably benign Het
Tbx19 A G 1: 165,138,977 S443P unknown Het
Tcea3 T A 4: 136,264,574 C190S probably damaging Het
Tfr2 G A 5: 137,574,439 V171I probably benign Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem129 A G 5: 33,657,778 V17A probably benign Het
Tmem2 T A 19: 21,801,885 V353D probably damaging Het
Tmem87b T C 2: 128,818,433 L32P probably damaging Het
Tor1aip1 T A 1: 156,030,431 D205V probably damaging Het
Trim33 T C 3: 103,331,758 V684A probably benign Het
Triobp C T 15: 78,993,178 R1637C probably damaging Het
Uhrf1bp1 A G 17: 27,893,440 D1201G probably damaging Het
Ulbp1 C A 10: 7,456,371 M196I probably benign Het
Vash1 G A 12: 86,691,889 G370E probably damaging Het
Vmn2r23 A G 6: 123,712,713 T183A probably benign Het
Vta1 A G 10: 14,655,839 I264T probably benign Het
Zcchc8 A T 5: 123,700,570 M635K probably benign Het
Other mutations in Otud4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Otud4 APN 8 79672881 missense probably damaging 0.99
IGL01353:Otud4 APN 8 79665021 missense probably benign
IGL01371:Otud4 APN 8 79673761 missense probably damaging 1.00
IGL01782:Otud4 APN 8 79673011 missense possibly damaging 0.95
IGL01912:Otud4 APN 8 79673837 missense probably benign
IGL02294:Otud4 APN 8 79664977 splice site probably benign
IGL02830:Otud4 APN 8 79673301 missense probably benign 0.00
IGL03063:Otud4 APN 8 79663790 missense probably benign 0.01
IGL03077:Otud4 APN 8 79673458 missense probably damaging 0.97
R0437:Otud4 UTSW 8 79669997 missense probably benign 0.02
R1024:Otud4 UTSW 8 79664093 missense probably benign 0.01
R1118:Otud4 UTSW 8 79653351 splice site probably benign
R1296:Otud4 UTSW 8 79673974 missense unknown
R1321:Otud4 UTSW 8 79669950 missense probably benign 0.03
R1674:Otud4 UTSW 8 79673147 missense probably benign 0.12
R1736:Otud4 UTSW 8 79651665 splice site probably benign
R1815:Otud4 UTSW 8 79639989 nonsense probably null
R1950:Otud4 UTSW 8 79646332 missense probably damaging 0.99
R1985:Otud4 UTSW 8 79640012 missense probably damaging 1.00
R2173:Otud4 UTSW 8 79668464 missense probably damaging 1.00
R2869:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2869:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2870:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2870:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2872:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2872:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2907:Otud4 UTSW 8 79673068 missense probably benign 0.02
R3545:Otud4 UTSW 8 79665055 missense probably damaging 1.00
R4628:Otud4 UTSW 8 79639968 missense possibly damaging 0.73
R4790:Otud4 UTSW 8 79666773 missense possibly damaging 0.82
R4989:Otud4 UTSW 8 79655689 missense probably damaging 1.00
R5133:Otud4 UTSW 8 79655689 missense probably damaging 1.00
R5134:Otud4 UTSW 8 79655689 missense probably damaging 1.00
R5294:Otud4 UTSW 8 79672892 missense possibly damaging 0.54
R5410:Otud4 UTSW 8 79672997 missense probably benign 0.04
R5454:Otud4 UTSW 8 79651042 missense possibly damaging 0.94
R5579:Otud4 UTSW 8 79664108 missense probably benign
R5738:Otud4 UTSW 8 79673461 missense probably benign 0.02
R5886:Otud4 UTSW 8 79672807 missense probably damaging 1.00
R6062:Otud4 UTSW 8 79673896 missense probably damaging 1.00
R6364:Otud4 UTSW 8 79646341 missense probably damaging 0.99
R6427:Otud4 UTSW 8 79668497 missense probably benign 0.00
R6450:Otud4 UTSW 8 79672997 missense probably benign 0.04
R6744:Otud4 UTSW 8 79673778 nonsense probably null
R6773:Otud4 UTSW 8 79643806 missense possibly damaging 0.95
R7046:Otud4 UTSW 8 79651042 missense possibly damaging 0.94
R7142:Otud4 UTSW 8 79672762 splice site probably null
R7420:Otud4 UTSW 8 79664108 missense probably benign 0.11
R7470:Otud4 UTSW 8 79673360 missense probably benign 0.00
R7670:Otud4 UTSW 8 79655864 splice site probably null
R7736:Otud4 UTSW 8 79655765 missense possibly damaging 0.53
R8229:Otud4 UTSW 8 79673975 missense unknown
R8397:Otud4 UTSW 8 79669298 missense probably benign 0.06
R8520:Otud4 UTSW 8 79659267 missense probably damaging 1.00
R9041:Otud4 UTSW 8 79673812 missense probably damaging 0.98
R9291:Otud4 UTSW 8 79646323 missense probably damaging 1.00
R9502:Otud4 UTSW 8 79673851 missense probably benign 0.01
X0024:Otud4 UTSW 8 79646310 missense probably benign 0.01
Z1176:Otud4 UTSW 8 79658929 missense probably benign
Z1177:Otud4 UTSW 8 79643811 nonsense probably null
Z1177:Otud4 UTSW 8 79643812 missense probably damaging 0.99
Z1177:Otud4 UTSW 8 79665027 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TCGTAGAAAATCCTGTAATGAGGC -3'
(R):5'- ACATCAGCAGCAGTCTTGGG -3'

Sequencing Primer
(F):5'- TGAGGCAAAATATTGTCCTGCCC -3'
(R):5'- CAGCAGCAGTCTTGGGATCTTTTAC -3'
Posted On 2022-07-18