Incidental Mutation 'R9495:Apoa5'
ID 717166
Institutional Source Beutler Lab
Gene Symbol Apoa5
Ensembl Gene ENSMUSG00000032079
Gene Name apolipoprotein A-V
Synonyms 1300007O05Rik, RAP3, Apoav
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9495 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 46179931-46183217 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 46181944 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Proline at position 340 (R340P)
Ref Sequence ENSEMBL: ENSMUSP00000034584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034584] [ENSMUST00000121598] [ENSMUST00000156440] [ENSMUST00000213878] [ENSMUST00000214202] [ENSMUST00000215187] [ENSMUST00000215458]
AlphaFold Q8C7G5
Predicted Effect probably damaging
Transcript: ENSMUST00000034584
AA Change: R340P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034584
Gene: ENSMUSG00000032079
AA Change: R340P

DomainStartEndE-ValueType
Pfam:Apolipoprotein 52 264 5.1e-59 PFAM
Pfam:Apolipoprotein 258 315 1.8e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114552
SMART Domains Protein: ENSMUSP00000110199
Gene: ENSMUSG00000032078

DomainStartEndE-ValueType
Zpr1 12 150 5.57e-30 SMART
Zpr1 184 343 4.27e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121598
AA Change: R340P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113413
Gene: ENSMUSG00000032079
AA Change: R340P

DomainStartEndE-ValueType
Pfam:Apolipoprotein 51 305 8.1e-66 PFAM
low complexity region 312 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125239
SMART Domains Protein: ENSMUSP00000123437
Gene: ENSMUSG00000032078

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
Blast:Zpr1 33 59 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000156440
SMART Domains Protein: ENSMUSP00000117725
Gene: ENSMUSG00000032078

DomainStartEndE-ValueType
low complexity region 9 30 N/A INTRINSIC
Zpr1 49 207 1.47e-93 SMART
low complexity region 236 246 N/A INTRINSIC
Zpr1 257 416 4.27e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213878
Predicted Effect probably benign
Transcript: ENSMUST00000214202
Predicted Effect probably benign
Transcript: ENSMUST00000215187
Predicted Effect probably benign
Transcript: ENSMUST00000215458
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an apolipoprotein that plays an important role in regulating the plasma triglyceride levels, a major risk factor for coronary artery disease. It is a component of high density lipoprotein and is highly similar to a rat protein that is upregulated in response to liver injury. Mutations in this gene have been associated with hypertriglyceridemia and hyperlipoproteinemia type 5. This gene is located proximal to the apolipoprotein gene cluster on chromosome 11q23. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in increased triglyceride and VLDL cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T A 15: 79,019,842 (GRCm39) D158V probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
Aadacl2fm1 T C 3: 59,840,114 (GRCm39) I62T possibly damaging Het
Acp5 G A 9: 22,038,483 (GRCm39) Q273* probably null Het
Atp2b1 T A 10: 98,835,660 (GRCm39) N468K probably damaging Het
Bltp3a A G 17: 28,112,414 (GRCm39) D1201G probably damaging Het
Bphl A T 13: 34,234,312 (GRCm39) I143L probably benign Het
Cd33 A T 7: 43,182,150 (GRCm39) H98Q probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Cemip2 T A 19: 21,779,249 (GRCm39) V353D probably damaging Het
Cfap96 C T 8: 46,409,458 (GRCm39) S287N probably damaging Het
Colec10 A G 15: 54,325,761 (GRCm39) D197G probably damaging Het
Cpt1a T C 19: 3,433,795 (GRCm39) M759T probably benign Het
Ctc1 A G 11: 68,913,593 (GRCm39) Y165C probably damaging Het
Cyp2t4 G A 7: 26,854,717 (GRCm39) V66M possibly damaging Het
Dnah2 T C 11: 69,345,208 (GRCm39) D2667G possibly damaging Het
Dok1 T C 6: 83,009,972 (GRCm39) K46E probably damaging Het
Erv3 C A 2: 131,697,975 (GRCm39) W128L possibly damaging Het
Fam186a A G 15: 99,844,766 (GRCm39) S493P unknown Het
Fbn1 A T 2: 125,160,984 (GRCm39) N2185K probably damaging Het
Figla A C 6: 85,997,689 (GRCm39) H139P probably benign Het
Gemin4 A G 11: 76,101,749 (GRCm39) L1004P probably damaging Het
Gm11937 T C 11: 99,500,646 (GRCm39) T124A unknown Het
Gm17669 G T 18: 67,695,682 (GRCm39) V76L probably benign Het
H2ac21 A G 3: 96,127,401 (GRCm39) E57G probably damaging Het
Hcls1 A T 16: 36,777,702 (GRCm39) M274L probably benign Het
Il17rc T C 6: 113,449,741 (GRCm39) S116P probably damaging Het
Krt79 G A 15: 101,840,288 (GRCm39) R303C probably damaging Het
Lamb2 C T 9: 108,358,006 (GRCm39) T149I probably damaging Het
Lrrc41 T A 4: 115,932,806 (GRCm39) probably null Het
Mga C A 2: 119,781,676 (GRCm39) T2234K possibly damaging Het
Mix23 A G 16: 35,892,491 (GRCm39) E12G probably benign Het
Muc6 T A 7: 141,237,398 (GRCm39) Q205L probably damaging Het
Nlrp9b A T 7: 19,760,462 (GRCm39) K624N possibly damaging Het
Or1o4 G T 17: 37,591,386 (GRCm39) probably benign Het
Or4d2 C T 11: 87,784,082 (GRCm39) V223M probably benign Het
Or6e1 T C 14: 54,520,137 (GRCm39) T72A probably damaging Het
Otud4 T C 8: 80,400,087 (GRCm39) S934P probably damaging Het
Pcdha12 G T 18: 37,155,526 (GRCm39) W748C probably damaging Het
Pdc T C 1: 150,208,919 (GRCm39) I134T probably damaging Het
Peg10 T TCCC 6: 4,756,451 (GRCm39) probably benign Het
Pkn1 C T 8: 84,410,799 (GRCm39) R276Q possibly damaging Het
Plin3 C A 17: 56,587,824 (GRCm39) G297V probably benign Het
Podn C T 4: 107,876,106 (GRCm39) V517I probably benign Het
Pomk T C 8: 26,473,344 (GRCm39) D203G probably damaging Het
Ppil4 A G 10: 7,675,355 (GRCm39) D168G probably damaging Het
Ptgr2 T C 12: 84,354,647 (GRCm39) I276T probably benign Het
Ptk7 T A 17: 46,887,744 (GRCm39) I563F possibly damaging Het
Rbm12 G T 2: 155,939,738 (GRCm39) T178K unknown Het
Sctr T C 1: 119,959,403 (GRCm39) probably null Het
Sh2b1 GGGACC GGGACCGGCTCAGCCACGTGGACC 7: 126,066,744 (GRCm39) probably benign Het
Spata31e4 T A 13: 50,855,465 (GRCm39) S368T possibly damaging Het
Steap1 A T 5: 5,786,458 (GRCm39) D326E probably damaging Het
Stra6 G A 9: 58,059,175 (GRCm39) V513I probably benign Het
Tbx19 A G 1: 164,966,546 (GRCm39) S443P unknown Het
Tcea3 T A 4: 135,991,885 (GRCm39) C190S probably damaging Het
Tfr2 G A 5: 137,572,701 (GRCm39) V171I probably benign Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tmem129 A G 5: 33,815,122 (GRCm39) V17A probably benign Het
Tmem87b T C 2: 128,660,353 (GRCm39) L32P probably damaging Het
Tor1aip1 T A 1: 155,906,177 (GRCm39) D205V probably damaging Het
Trim33 T C 3: 103,239,074 (GRCm39) V684A probably benign Het
Triobp C T 15: 78,877,378 (GRCm39) R1637C probably damaging Het
Ulbp1 C A 10: 7,406,371 (GRCm39) M196I probably benign Het
Vash1 G A 12: 86,738,663 (GRCm39) G370E probably damaging Het
Vmn2r23 A G 6: 123,689,672 (GRCm39) T183A probably benign Het
Vta1 A G 10: 14,531,583 (GRCm39) I264T probably benign Het
Zcchc8 A T 5: 123,838,633 (GRCm39) M635K probably benign Het
Other mutations in Apoa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02084:Apoa5 APN 9 46,181,950 (GRCm39) missense probably damaging 0.98
IGL02089:Apoa5 APN 9 46,180,437 (GRCm39) critical splice donor site probably null
R0046:Apoa5 UTSW 9 46,181,296 (GRCm39) missense probably damaging 1.00
R1722:Apoa5 UTSW 9 46,181,847 (GRCm39) nonsense probably null
R2007:Apoa5 UTSW 9 46,181,665 (GRCm39) missense possibly damaging 0.95
R2356:Apoa5 UTSW 9 46,181,341 (GRCm39) missense probably damaging 0.98
R3739:Apoa5 UTSW 9 46,180,415 (GRCm39) missense probably damaging 1.00
R3835:Apoa5 UTSW 9 46,181,878 (GRCm39) missense probably damaging 1.00
R4364:Apoa5 UTSW 9 46,181,827 (GRCm39) missense probably damaging 1.00
R4657:Apoa5 UTSW 9 46,181,170 (GRCm39) missense probably benign 0.12
R4760:Apoa5 UTSW 9 46,181,593 (GRCm39) missense probably damaging 0.97
R5160:Apoa5 UTSW 9 46,181,794 (GRCm39) missense probably damaging 0.99
R5523:Apoa5 UTSW 9 46,181,887 (GRCm39) missense possibly damaging 0.79
R5915:Apoa5 UTSW 9 46,180,607 (GRCm39) missense probably damaging 1.00
R6106:Apoa5 UTSW 9 46,181,931 (GRCm39) nonsense probably null
R6849:Apoa5 UTSW 9 46,181,298 (GRCm39) missense probably benign 0.03
R7170:Apoa5 UTSW 9 46,181,437 (GRCm39) missense probably benign 0.00
R9268:Apoa5 UTSW 9 46,181,719 (GRCm39) missense probably benign 0.18
R9403:Apoa5 UTSW 9 46,181,944 (GRCm39) missense probably damaging 1.00
R9499:Apoa5 UTSW 9 46,181,944 (GRCm39) missense probably damaging 1.00
Z1177:Apoa5 UTSW 9 46,180,417 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTTCGGCATGACACCTACC -3'
(R):5'- CCTACTGAGTGTAATGCCCCTG -3'

Sequencing Primer
(F):5'- ATGACACCTACCTGCAGATTGCTG -3'
(R):5'- CTACTGAGTGTAATGCCCCTGAGTAG -3'
Posted On 2022-07-18