Incidental Mutation 'R9495:Apoa5'
ID 717166
Institutional Source Beutler Lab
Gene Symbol Apoa5
Ensembl Gene ENSMUSG00000032079
Gene Name apolipoprotein A-V
Synonyms 1300007O05Rik, RAP3, Apoav
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9495 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 46268633-46271919 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 46270646 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Proline at position 340 (R340P)
Ref Sequence ENSEMBL: ENSMUSP00000034584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034584] [ENSMUST00000121598] [ENSMUST00000156440] [ENSMUST00000213878] [ENSMUST00000214202] [ENSMUST00000215187] [ENSMUST00000215458]
AlphaFold Q8C7G5
Predicted Effect probably damaging
Transcript: ENSMUST00000034584
AA Change: R340P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034584
Gene: ENSMUSG00000032079
AA Change: R340P

DomainStartEndE-ValueType
Pfam:Apolipoprotein 52 264 5.1e-59 PFAM
Pfam:Apolipoprotein 258 315 1.8e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114552
SMART Domains Protein: ENSMUSP00000110199
Gene: ENSMUSG00000032078

DomainStartEndE-ValueType
Zpr1 12 150 5.57e-30 SMART
Zpr1 184 343 4.27e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121598
AA Change: R340P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113413
Gene: ENSMUSG00000032079
AA Change: R340P

DomainStartEndE-ValueType
Pfam:Apolipoprotein 51 305 8.1e-66 PFAM
low complexity region 312 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125239
SMART Domains Protein: ENSMUSP00000123437
Gene: ENSMUSG00000032078

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
Blast:Zpr1 33 59 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000156440
SMART Domains Protein: ENSMUSP00000117725
Gene: ENSMUSG00000032078

DomainStartEndE-ValueType
low complexity region 9 30 N/A INTRINSIC
Zpr1 49 207 1.47e-93 SMART
low complexity region 236 246 N/A INTRINSIC
Zpr1 257 416 4.27e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213878
Predicted Effect probably benign
Transcript: ENSMUST00000214202
Predicted Effect probably benign
Transcript: ENSMUST00000215187
Predicted Effect probably benign
Transcript: ENSMUST00000215458
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an apolipoprotein that plays an important role in regulating the plasma triglyceride levels, a major risk factor for coronary artery disease. It is a component of high density lipoprotein and is highly similar to a rat protein that is upregulated in response to liver injury. Mutations in this gene have been associated with hypertriglyceridemia and hyperlipoproteinemia type 5. This gene is located proximal to the apolipoprotein gene cluster on chromosome 11q23. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in increased triglyceride and VLDL cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik C T 8: 45,956,421 S287N probably damaging Het
1700088E04Rik T A 15: 79,135,642 D158V probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Acp5 G A 9: 22,127,187 Q273* probably null Het
Atp2b1 T A 10: 98,999,798 N468K probably damaging Het
Bphl A T 13: 34,050,329 I143L probably benign Het
C130079G13Rik T C 3: 59,932,693 I62T possibly damaging Het
Ccdc58 A G 16: 36,072,121 E12G probably benign Het
Cd33 A T 7: 43,532,726 H98Q probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Colec10 A G 15: 54,462,365 D197G probably damaging Het
Cpt1a T C 19: 3,383,795 M759T probably benign Het
Ctc1 A G 11: 69,022,767 Y165C probably damaging Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Dnah2 T C 11: 69,454,382 D2667G possibly damaging Het
Dok1 T C 6: 83,032,991 K46E probably damaging Het
Erv3 C A 2: 131,856,055 W128L possibly damaging Het
Fam186a A G 15: 99,946,885 S493P unknown Het
Fbn1 A T 2: 125,319,064 N2185K probably damaging Het
Figla A C 6: 86,020,707 H139P probably benign Het
Gemin4 A G 11: 76,210,923 L1004P probably damaging Het
Gm11937 T C 11: 99,609,820 T124A unknown Het
Gm17669 G T 18: 67,562,612 V76L probably benign Het
Gm8765 T A 13: 50,701,429 S368T possibly damaging Het
Hcls1 A T 16: 36,957,340 M274L probably benign Het
Hist2h2ab A G 3: 96,220,085 E57G probably damaging Het
Il17rc T C 6: 113,472,780 S116P probably damaging Het
Krt79 G A 15: 101,931,853 R303C probably damaging Het
Lamb2 C T 9: 108,480,807 T149I probably damaging Het
Lrrc41 T A 4: 116,075,609 probably null Het
Mga C A 2: 119,951,195 T2234K possibly damaging Het
Muc6 T A 7: 141,651,133 Q205L probably damaging Het
Nlrp9b A T 7: 20,026,537 K624N possibly damaging Het
Olfr463 C T 11: 87,893,256 V223M probably benign Het
Olfr49 T C 14: 54,282,680 T72A probably damaging Het
Olfr99 G T 17: 37,280,495 probably benign Het
Otud4 T C 8: 79,673,458 S934P probably damaging Het
Pcdha12 G T 18: 37,022,473 W748C probably damaging Het
Pdc T C 1: 150,333,168 I134T probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Pkn1 C T 8: 83,684,170 R276Q possibly damaging Het
Plin3 C A 17: 56,280,824 G297V probably benign Het
Podn C T 4: 108,018,909 V517I probably benign Het
Pomk T C 8: 25,983,316 D203G probably damaging Het
Ppil4 A G 10: 7,799,591 D168G probably damaging Het
Ptgr2 T C 12: 84,307,873 I276T probably benign Het
Ptk7 T A 17: 46,576,818 I563F possibly damaging Het
Rbm12 G T 2: 156,097,818 T178K unknown Het
Sctr T C 1: 120,031,673 probably null Het
Sh2b1 GGGACC GGGACCGGCTCAGCCACGTGGACC 7: 126,467,572 probably benign Het
Steap1 A T 5: 5,736,458 D326E probably damaging Het
Stra6 G A 9: 58,151,892 V513I probably benign Het
Tbx19 A G 1: 165,138,977 S443P unknown Het
Tcea3 T A 4: 136,264,574 C190S probably damaging Het
Tfr2 G A 5: 137,574,439 V171I probably benign Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem129 A G 5: 33,657,778 V17A probably benign Het
Tmem2 T A 19: 21,801,885 V353D probably damaging Het
Tmem87b T C 2: 128,818,433 L32P probably damaging Het
Tor1aip1 T A 1: 156,030,431 D205V probably damaging Het
Trim33 T C 3: 103,331,758 V684A probably benign Het
Triobp C T 15: 78,993,178 R1637C probably damaging Het
Uhrf1bp1 A G 17: 27,893,440 D1201G probably damaging Het
Ulbp1 C A 10: 7,456,371 M196I probably benign Het
Vash1 G A 12: 86,691,889 G370E probably damaging Het
Vmn2r23 A G 6: 123,712,713 T183A probably benign Het
Vta1 A G 10: 14,655,839 I264T probably benign Het
Zcchc8 A T 5: 123,700,570 M635K probably benign Het
Other mutations in Apoa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02084:Apoa5 APN 9 46270652 missense probably damaging 0.98
IGL02089:Apoa5 APN 9 46269139 critical splice donor site probably null
R0046:Apoa5 UTSW 9 46269998 missense probably damaging 1.00
R1722:Apoa5 UTSW 9 46270549 nonsense probably null
R2007:Apoa5 UTSW 9 46270367 missense possibly damaging 0.95
R2356:Apoa5 UTSW 9 46270043 missense probably damaging 0.98
R3739:Apoa5 UTSW 9 46269117 missense probably damaging 1.00
R3835:Apoa5 UTSW 9 46270580 missense probably damaging 1.00
R4364:Apoa5 UTSW 9 46270529 missense probably damaging 1.00
R4657:Apoa5 UTSW 9 46269872 missense probably benign 0.12
R4760:Apoa5 UTSW 9 46270295 missense probably damaging 0.97
R5160:Apoa5 UTSW 9 46270496 missense probably damaging 0.99
R5523:Apoa5 UTSW 9 46270589 missense possibly damaging 0.79
R5915:Apoa5 UTSW 9 46269309 missense probably damaging 1.00
R6106:Apoa5 UTSW 9 46270633 nonsense probably null
R6849:Apoa5 UTSW 9 46270000 missense probably benign 0.03
R7170:Apoa5 UTSW 9 46270139 missense probably benign 0.00
R9268:Apoa5 UTSW 9 46270421 missense probably benign 0.18
R9403:Apoa5 UTSW 9 46270646 missense probably damaging 1.00
R9499:Apoa5 UTSW 9 46270646 missense probably damaging 1.00
Z1177:Apoa5 UTSW 9 46269119 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTTCGGCATGACACCTACC -3'
(R):5'- CCTACTGAGTGTAATGCCCCTG -3'

Sequencing Primer
(F):5'- ATGACACCTACCTGCAGATTGCTG -3'
(R):5'- CTACTGAGTGTAATGCCCCTGAGTAG -3'
Posted On 2022-07-18