Incidental Mutation 'R9495:Ulbp1'
ID 717169
Institutional Source Beutler Lab
Gene Symbol Ulbp1
Ensembl Gene ENSMUSG00000079685
Gene Name UL16 binding protein 1
Synonyms A430108B07Rik, MULT1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.111) question?
Stock # R9495 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 7394873-7423643 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 7406371 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 196 (M196I)
Ref Sequence ENSEMBL: ENSMUSP00000136637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169796] [ENSMUST00000177585] [ENSMUST00000218087]
AlphaFold Q8HWA3
Predicted Effect probably benign
Transcript: ENSMUST00000169796
AA Change: M196I

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128204
Gene: ENSMUSG00000079685
AA Change: M196I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
PDB:1KCG|C 31 119 2e-7 PDB
transmembrane domain 124 146 N/A INTRINSIC
internal_repeat_1 148 174 1.72e-7 PROSPERO
internal_repeat_1 193 219 1.72e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000177585
AA Change: M196I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000136637
Gene: ENSMUSG00000079685
AA Change: M196I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
PDB:1KCG|C 46 204 7e-10 PDB
transmembrane domain 209 231 N/A INTRINSIC
internal_repeat_1 233 259 5.4e-7 PROSPERO
internal_repeat_1 278 304 5.4e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000218087
AA Change: M111I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ligand of natural killer group 2, member D (NKG2D), an immune system-activating receptor on NK cells and T-cells. Binding of the encoded ligand to NKG2D leads to activation of several signal transduction pathways, including those of JAK2, STAT5, ERK and PI3K kinase/Akt. Also, in cytomegalovirus-infected cells, this ligand binds the UL16 glycoprotein and is prevented from activating the immune system. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T A 15: 79,019,842 (GRCm39) D158V probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
Aadacl2fm1 T C 3: 59,840,114 (GRCm39) I62T possibly damaging Het
Acp5 G A 9: 22,038,483 (GRCm39) Q273* probably null Het
Apoa5 G C 9: 46,181,944 (GRCm39) R340P probably damaging Het
Atp2b1 T A 10: 98,835,660 (GRCm39) N468K probably damaging Het
Bltp3a A G 17: 28,112,414 (GRCm39) D1201G probably damaging Het
Bphl A T 13: 34,234,312 (GRCm39) I143L probably benign Het
Cd33 A T 7: 43,182,150 (GRCm39) H98Q probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Cemip2 T A 19: 21,779,249 (GRCm39) V353D probably damaging Het
Cfap96 C T 8: 46,409,458 (GRCm39) S287N probably damaging Het
Colec10 A G 15: 54,325,761 (GRCm39) D197G probably damaging Het
Cpt1a T C 19: 3,433,795 (GRCm39) M759T probably benign Het
Ctc1 A G 11: 68,913,593 (GRCm39) Y165C probably damaging Het
Cyp2t4 G A 7: 26,854,717 (GRCm39) V66M possibly damaging Het
Dnah2 T C 11: 69,345,208 (GRCm39) D2667G possibly damaging Het
Dok1 T C 6: 83,009,972 (GRCm39) K46E probably damaging Het
Erv3 C A 2: 131,697,975 (GRCm39) W128L possibly damaging Het
Fam186a A G 15: 99,844,766 (GRCm39) S493P unknown Het
Fbn1 A T 2: 125,160,984 (GRCm39) N2185K probably damaging Het
Figla A C 6: 85,997,689 (GRCm39) H139P probably benign Het
Gemin4 A G 11: 76,101,749 (GRCm39) L1004P probably damaging Het
Gm11937 T C 11: 99,500,646 (GRCm39) T124A unknown Het
Gm17669 G T 18: 67,695,682 (GRCm39) V76L probably benign Het
H2ac21 A G 3: 96,127,401 (GRCm39) E57G probably damaging Het
Hcls1 A T 16: 36,777,702 (GRCm39) M274L probably benign Het
Il17rc T C 6: 113,449,741 (GRCm39) S116P probably damaging Het
Krt79 G A 15: 101,840,288 (GRCm39) R303C probably damaging Het
Lamb2 C T 9: 108,358,006 (GRCm39) T149I probably damaging Het
Lrrc41 T A 4: 115,932,806 (GRCm39) probably null Het
Mga C A 2: 119,781,676 (GRCm39) T2234K possibly damaging Het
Mix23 A G 16: 35,892,491 (GRCm39) E12G probably benign Het
Muc6 T A 7: 141,237,398 (GRCm39) Q205L probably damaging Het
Nlrp9b A T 7: 19,760,462 (GRCm39) K624N possibly damaging Het
Or1o4 G T 17: 37,591,386 (GRCm39) probably benign Het
Or4d2 C T 11: 87,784,082 (GRCm39) V223M probably benign Het
Or6e1 T C 14: 54,520,137 (GRCm39) T72A probably damaging Het
Otud4 T C 8: 80,400,087 (GRCm39) S934P probably damaging Het
Pcdha12 G T 18: 37,155,526 (GRCm39) W748C probably damaging Het
Pdc T C 1: 150,208,919 (GRCm39) I134T probably damaging Het
Peg10 T TCCC 6: 4,756,451 (GRCm39) probably benign Het
Pkn1 C T 8: 84,410,799 (GRCm39) R276Q possibly damaging Het
Plin3 C A 17: 56,587,824 (GRCm39) G297V probably benign Het
Podn C T 4: 107,876,106 (GRCm39) V517I probably benign Het
Pomk T C 8: 26,473,344 (GRCm39) D203G probably damaging Het
Ppil4 A G 10: 7,675,355 (GRCm39) D168G probably damaging Het
Ptgr2 T C 12: 84,354,647 (GRCm39) I276T probably benign Het
Ptk7 T A 17: 46,887,744 (GRCm39) I563F possibly damaging Het
Rbm12 G T 2: 155,939,738 (GRCm39) T178K unknown Het
Sctr T C 1: 119,959,403 (GRCm39) probably null Het
Sh2b1 GGGACC GGGACCGGCTCAGCCACGTGGACC 7: 126,066,744 (GRCm39) probably benign Het
Spata31e4 T A 13: 50,855,465 (GRCm39) S368T possibly damaging Het
Steap1 A T 5: 5,786,458 (GRCm39) D326E probably damaging Het
Stra6 G A 9: 58,059,175 (GRCm39) V513I probably benign Het
Tbx19 A G 1: 164,966,546 (GRCm39) S443P unknown Het
Tcea3 T A 4: 135,991,885 (GRCm39) C190S probably damaging Het
Tfr2 G A 5: 137,572,701 (GRCm39) V171I probably benign Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tmem129 A G 5: 33,815,122 (GRCm39) V17A probably benign Het
Tmem87b T C 2: 128,660,353 (GRCm39) L32P probably damaging Het
Tor1aip1 T A 1: 155,906,177 (GRCm39) D205V probably damaging Het
Trim33 T C 3: 103,239,074 (GRCm39) V684A probably benign Het
Triobp C T 15: 78,877,378 (GRCm39) R1637C probably damaging Het
Vash1 G A 12: 86,738,663 (GRCm39) G370E probably damaging Het
Vmn2r23 A G 6: 123,689,672 (GRCm39) T183A probably benign Het
Vta1 A G 10: 14,531,583 (GRCm39) I264T probably benign Het
Zcchc8 A T 5: 123,838,633 (GRCm39) M635K probably benign Het
Other mutations in Ulbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1463:Ulbp1 UTSW 10 7,396,557 (GRCm39) splice site probably benign
R2309:Ulbp1 UTSW 10 7,397,388 (GRCm39) missense probably benign 0.03
R4486:Ulbp1 UTSW 10 7,397,397 (GRCm39) missense probably benign 0.03
R4542:Ulbp1 UTSW 10 7,406,570 (GRCm39) missense probably damaging 1.00
R4977:Ulbp1 UTSW 10 7,397,391 (GRCm39) missense probably benign 0.31
R5568:Ulbp1 UTSW 10 7,423,281 (GRCm39) missense unknown
R7705:Ulbp1 UTSW 10 7,395,685 (GRCm39) missense unknown
R7943:Ulbp1 UTSW 10 7,407,053 (GRCm39) missense probably damaging 0.98
R9177:Ulbp1 UTSW 10 7,396,392 (GRCm39) missense unknown
R9268:Ulbp1 UTSW 10 7,396,392 (GRCm39) missense unknown
R9502:Ulbp1 UTSW 10 7,423,260 (GRCm39) missense probably benign 0.19
RF009:Ulbp1 UTSW 10 7,397,405 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AAACACAGTACATTTGTTCACTGAG -3'
(R):5'- GTGTGTGGCCAGTATGAAGTAGAC -3'

Sequencing Primer
(F):5'- CACTGAGATTGTCATGCTTGCATAC -3'
(R):5'- AGGATACGCCATTGTTAGCC -3'
Posted On 2022-07-18