Incidental Mutation 'R9495:Fam186a'
ID 717187
Institutional Source Beutler Lab
Gene Symbol Fam186a
Ensembl Gene ENSMUSG00000045350
Gene Name family with sequence similarity 186, member A
Synonyms LOC380973, 1700030F18Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R9495 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 99816229-99864942 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 99844766 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 493 (S493P)
Ref Sequence ENSEMBL: ENSMUSP00000097783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100209]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000100209
AA Change: S493P
SMART Domains Protein: ENSMUSP00000097783
Gene: ENSMUSG00000045350
AA Change: S493P

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:FBG 44 222 4e-48 BLAST
coiled coil region 292 340 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 446 458 N/A INTRINSIC
low complexity region 632 644 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
internal_repeat_2 743 1156 1.05e-58 PROSPERO
internal_repeat_1 833 1270 7.71e-59 PROSPERO
low complexity region 1271 1285 N/A INTRINSIC
low complexity region 1289 1300 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1327 1338 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1365 1376 N/A INTRINSIC
low complexity region 1384 1395 N/A INTRINSIC
low complexity region 1403 1414 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1441 1452 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1498 1509 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1536 1547 N/A INTRINSIC
low complexity region 1555 1566 N/A INTRINSIC
low complexity region 1574 1585 N/A INTRINSIC
internal_repeat_1 1586 1981 7.71e-59 PROSPERO
internal_repeat_2 1737 2197 1.05e-58 PROSPERO
low complexity region 2367 2378 N/A INTRINSIC
low complexity region 2549 2564 N/A INTRINSIC
low complexity region 2644 2655 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T A 15: 79,019,842 (GRCm39) D158V probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
Aadacl2fm1 T C 3: 59,840,114 (GRCm39) I62T possibly damaging Het
Acp5 G A 9: 22,038,483 (GRCm39) Q273* probably null Het
Apoa5 G C 9: 46,181,944 (GRCm39) R340P probably damaging Het
Atp2b1 T A 10: 98,835,660 (GRCm39) N468K probably damaging Het
Bltp3a A G 17: 28,112,414 (GRCm39) D1201G probably damaging Het
Bphl A T 13: 34,234,312 (GRCm39) I143L probably benign Het
Cd33 A T 7: 43,182,150 (GRCm39) H98Q probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Cemip2 T A 19: 21,779,249 (GRCm39) V353D probably damaging Het
Cfap96 C T 8: 46,409,458 (GRCm39) S287N probably damaging Het
Colec10 A G 15: 54,325,761 (GRCm39) D197G probably damaging Het
Cpt1a T C 19: 3,433,795 (GRCm39) M759T probably benign Het
Ctc1 A G 11: 68,913,593 (GRCm39) Y165C probably damaging Het
Cyp2t4 G A 7: 26,854,717 (GRCm39) V66M possibly damaging Het
Dnah2 T C 11: 69,345,208 (GRCm39) D2667G possibly damaging Het
Dok1 T C 6: 83,009,972 (GRCm39) K46E probably damaging Het
Erv3 C A 2: 131,697,975 (GRCm39) W128L possibly damaging Het
Fbn1 A T 2: 125,160,984 (GRCm39) N2185K probably damaging Het
Figla A C 6: 85,997,689 (GRCm39) H139P probably benign Het
Gemin4 A G 11: 76,101,749 (GRCm39) L1004P probably damaging Het
Gm11937 T C 11: 99,500,646 (GRCm39) T124A unknown Het
Gm17669 G T 18: 67,695,682 (GRCm39) V76L probably benign Het
H2ac21 A G 3: 96,127,401 (GRCm39) E57G probably damaging Het
Hcls1 A T 16: 36,777,702 (GRCm39) M274L probably benign Het
Il17rc T C 6: 113,449,741 (GRCm39) S116P probably damaging Het
Krt79 G A 15: 101,840,288 (GRCm39) R303C probably damaging Het
Lamb2 C T 9: 108,358,006 (GRCm39) T149I probably damaging Het
Lrrc41 T A 4: 115,932,806 (GRCm39) probably null Het
Mga C A 2: 119,781,676 (GRCm39) T2234K possibly damaging Het
Mix23 A G 16: 35,892,491 (GRCm39) E12G probably benign Het
Muc6 T A 7: 141,237,398 (GRCm39) Q205L probably damaging Het
Nlrp9b A T 7: 19,760,462 (GRCm39) K624N possibly damaging Het
Or1o4 G T 17: 37,591,386 (GRCm39) probably benign Het
Or4d2 C T 11: 87,784,082 (GRCm39) V223M probably benign Het
Or6e1 T C 14: 54,520,137 (GRCm39) T72A probably damaging Het
Otud4 T C 8: 80,400,087 (GRCm39) S934P probably damaging Het
Pcdha12 G T 18: 37,155,526 (GRCm39) W748C probably damaging Het
Pdc T C 1: 150,208,919 (GRCm39) I134T probably damaging Het
Peg10 T TCCC 6: 4,756,451 (GRCm39) probably benign Het
Pkn1 C T 8: 84,410,799 (GRCm39) R276Q possibly damaging Het
Plin3 C A 17: 56,587,824 (GRCm39) G297V probably benign Het
Podn C T 4: 107,876,106 (GRCm39) V517I probably benign Het
Pomk T C 8: 26,473,344 (GRCm39) D203G probably damaging Het
Ppil4 A G 10: 7,675,355 (GRCm39) D168G probably damaging Het
Ptgr2 T C 12: 84,354,647 (GRCm39) I276T probably benign Het
Ptk7 T A 17: 46,887,744 (GRCm39) I563F possibly damaging Het
Rbm12 G T 2: 155,939,738 (GRCm39) T178K unknown Het
Sctr T C 1: 119,959,403 (GRCm39) probably null Het
Sh2b1 GGGACC GGGACCGGCTCAGCCACGTGGACC 7: 126,066,744 (GRCm39) probably benign Het
Spata31e4 T A 13: 50,855,465 (GRCm39) S368T possibly damaging Het
Steap1 A T 5: 5,786,458 (GRCm39) D326E probably damaging Het
Stra6 G A 9: 58,059,175 (GRCm39) V513I probably benign Het
Tbx19 A G 1: 164,966,546 (GRCm39) S443P unknown Het
Tcea3 T A 4: 135,991,885 (GRCm39) C190S probably damaging Het
Tfr2 G A 5: 137,572,701 (GRCm39) V171I probably benign Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tmem129 A G 5: 33,815,122 (GRCm39) V17A probably benign Het
Tmem87b T C 2: 128,660,353 (GRCm39) L32P probably damaging Het
Tor1aip1 T A 1: 155,906,177 (GRCm39) D205V probably damaging Het
Trim33 T C 3: 103,239,074 (GRCm39) V684A probably benign Het
Triobp C T 15: 78,877,378 (GRCm39) R1637C probably damaging Het
Ulbp1 C A 10: 7,406,371 (GRCm39) M196I probably benign Het
Vash1 G A 12: 86,738,663 (GRCm39) G370E probably damaging Het
Vmn2r23 A G 6: 123,689,672 (GRCm39) T183A probably benign Het
Vta1 A G 10: 14,531,583 (GRCm39) I264T probably benign Het
Zcchc8 A T 5: 123,838,633 (GRCm39) M635K probably benign Het
Other mutations in Fam186a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Fam186a APN 15 99,825,572 (GRCm39) splice site probably benign
IGL03047:Fam186a UTSW 15 99,843,589 (GRCm39) missense unknown
R0172:Fam186a UTSW 15 99,852,768 (GRCm39) missense unknown
R0194:Fam186a UTSW 15 99,839,644 (GRCm39) missense possibly damaging 0.92
R0381:Fam186a UTSW 15 99,840,055 (GRCm39) missense probably damaging 0.97
R0799:Fam186a UTSW 15 99,839,893 (GRCm39) missense probably damaging 1.00
R1295:Fam186a UTSW 15 99,837,670 (GRCm39) splice site probably benign
R1366:Fam186a UTSW 15 99,841,270 (GRCm39) missense possibly damaging 0.89
R1519:Fam186a UTSW 15 99,845,536 (GRCm39) missense unknown
R1592:Fam186a UTSW 15 99,838,199 (GRCm39) missense probably benign 0.01
R1636:Fam186a UTSW 15 99,839,539 (GRCm39) missense unknown
R1719:Fam186a UTSW 15 99,840,227 (GRCm39) missense possibly damaging 0.54
R1759:Fam186a UTSW 15 99,864,762 (GRCm39) nonsense probably null
R1856:Fam186a UTSW 15 99,838,183 (GRCm39) missense possibly damaging 0.82
R2131:Fam186a UTSW 15 99,831,557 (GRCm39) unclassified probably benign
R2192:Fam186a UTSW 15 99,838,192 (GRCm39) missense possibly damaging 0.90
R2239:Fam186a UTSW 15 99,852,745 (GRCm39) missense unknown
R2251:Fam186a UTSW 15 99,842,978 (GRCm39) missense probably benign 0.02
R2902:Fam186a UTSW 15 99,843,049 (GRCm39) missense possibly damaging 0.73
R3037:Fam186a UTSW 15 99,841,675 (GRCm39) missense probably damaging 0.99
R3744:Fam186a UTSW 15 99,845,416 (GRCm39) missense unknown
R4021:Fam186a UTSW 15 99,839,680 (GRCm39) missense possibly damaging 0.66
R4183:Fam186a UTSW 15 99,831,566 (GRCm39) unclassified probably benign
R4238:Fam186a UTSW 15 99,841,523 (GRCm39) missense probably benign 0.05
R4667:Fam186a UTSW 15 99,842,413 (GRCm39) missense possibly damaging 0.92
R4817:Fam186a UTSW 15 99,831,419 (GRCm39) unclassified probably benign
R4835:Fam186a UTSW 15 99,843,689 (GRCm39) missense unknown
R4837:Fam186a UTSW 15 99,838,678 (GRCm39) missense unknown
R4897:Fam186a UTSW 15 99,843,158 (GRCm39) missense possibly damaging 0.66
R4902:Fam186a UTSW 15 99,844,723 (GRCm39) missense unknown
R4950:Fam186a UTSW 15 99,839,534 (GRCm39) missense unknown
R4995:Fam186a UTSW 15 99,842,980 (GRCm39) missense probably benign 0.27
R5062:Fam186a UTSW 15 99,842,527 (GRCm39) missense possibly damaging 0.66
R5124:Fam186a UTSW 15 99,840,977 (GRCm39) missense possibly damaging 0.90
R5133:Fam186a UTSW 15 99,853,374 (GRCm39) missense unknown
R5424:Fam186a UTSW 15 99,843,644 (GRCm39) missense unknown
R5624:Fam186a UTSW 15 99,839,628 (GRCm39) missense possibly damaging 0.90
R5628:Fam186a UTSW 15 99,839,628 (GRCm39) missense possibly damaging 0.90
R5637:Fam186a UTSW 15 99,839,628 (GRCm39) missense possibly damaging 0.90
R5639:Fam186a UTSW 15 99,844,931 (GRCm39) missense unknown
R5652:Fam186a UTSW 15 99,843,253 (GRCm39) missense possibly damaging 0.79
R5673:Fam186a UTSW 15 99,839,628 (GRCm39) missense possibly damaging 0.90
R5799:Fam186a UTSW 15 99,864,705 (GRCm39) nonsense probably null
R5965:Fam186a UTSW 15 99,842,978 (GRCm39) missense probably benign 0.37
R6044:Fam186a UTSW 15 99,839,878 (GRCm39) missense probably damaging 0.97
R6077:Fam186a UTSW 15 99,840,584 (GRCm39) missense possibly damaging 0.46
R6120:Fam186a UTSW 15 99,838,244 (GRCm39) missense probably benign 0.00
R6185:Fam186a UTSW 15 99,845,530 (GRCm39) missense unknown
R6186:Fam186a UTSW 15 99,845,206 (GRCm39) missense unknown
R6242:Fam186a UTSW 15 99,837,788 (GRCm39) missense unknown
R6351:Fam186a UTSW 15 99,839,623 (GRCm39) missense probably damaging 0.97
R6368:Fam186a UTSW 15 99,841,198 (GRCm39) missense possibly damaging 0.66
R6369:Fam186a UTSW 15 99,845,212 (GRCm39) missense unknown
R6559:Fam186a UTSW 15 99,842,356 (GRCm39) missense possibly damaging 0.46
R6855:Fam186a UTSW 15 99,852,756 (GRCm39) missense unknown
R6867:Fam186a UTSW 15 99,843,731 (GRCm39) missense unknown
R6957:Fam186a UTSW 15 99,844,357 (GRCm39) missense unknown
R6961:Fam186a UTSW 15 99,838,082 (GRCm39) missense probably benign 0.16
R6994:Fam186a UTSW 15 99,840,347 (GRCm39) missense probably benign 0.35
R6996:Fam186a UTSW 15 99,853,374 (GRCm39) missense unknown
R7062:Fam186a UTSW 15 99,831,521 (GRCm39) unclassified probably benign
R7064:Fam186a UTSW 15 99,839,557 (GRCm39) missense unknown
R7173:Fam186a UTSW 15 99,843,531 (GRCm39) missense unknown
R7244:Fam186a UTSW 15 99,844,273 (GRCm39) missense unknown
R7270:Fam186a UTSW 15 99,842,033 (GRCm39) missense possibly damaging 0.66
R7410:Fam186a UTSW 15 99,844,826 (GRCm39) nonsense probably null
R7437:Fam186a UTSW 15 99,840,775 (GRCm39) missense probably damaging 1.00
R7475:Fam186a UTSW 15 99,845,395 (GRCm39) missense unknown
R7487:Fam186a UTSW 15 99,840,017 (GRCm39) missense possibly damaging 0.66
R7526:Fam186a UTSW 15 99,839,796 (GRCm39) missense possibly damaging 0.83
R7650:Fam186a UTSW 15 99,837,788 (GRCm39) missense unknown
R7658:Fam186a UTSW 15 99,837,725 (GRCm39) missense unknown
R7663:Fam186a UTSW 15 99,842,950 (GRCm39) missense probably benign 0.00
R7703:Fam186a UTSW 15 99,852,678 (GRCm39) missense unknown
R7814:Fam186a UTSW 15 99,842,545 (GRCm39) missense possibly damaging 0.92
R7958:Fam186a UTSW 15 99,841,189 (GRCm39) missense probably damaging 0.99
R7970:Fam186a UTSW 15 99,831,467 (GRCm39) missense unknown
R8076:Fam186a UTSW 15 99,841,351 (GRCm39) missense possibly damaging 0.83
R8087:Fam186a UTSW 15 99,839,725 (GRCm39) missense possibly damaging 0.46
R8130:Fam186a UTSW 15 99,841,914 (GRCm39) frame shift probably null
R8239:Fam186a UTSW 15 99,839,191 (GRCm39) missense unknown
R8246:Fam186a UTSW 15 99,838,428 (GRCm39) missense unknown
R8446:Fam186a UTSW 15 99,845,335 (GRCm39) missense unknown
R8469:Fam186a UTSW 15 99,845,186 (GRCm39) missense unknown
R8676:Fam186a UTSW 15 99,845,023 (GRCm39) missense unknown
R8790:Fam186a UTSW 15 99,841,024 (GRCm39) missense possibly damaging 0.90
R8808:Fam186a UTSW 15 99,842,604 (GRCm39) missense possibly damaging 0.83
R8848:Fam186a UTSW 15 99,838,034 (GRCm39) missense possibly damaging 0.83
R9083:Fam186a UTSW 15 99,843,079 (GRCm39) missense probably benign 0.27
R9106:Fam186a UTSW 15 99,844,107 (GRCm39) small deletion probably benign
R9116:Fam186a UTSW 15 99,840,472 (GRCm39) missense possibly damaging 0.95
R9156:Fam186a UTSW 15 99,841,159 (GRCm39) missense possibly damaging 0.46
R9227:Fam186a UTSW 15 99,853,384 (GRCm39) missense unknown
R9250:Fam186a UTSW 15 99,845,330 (GRCm39) missense unknown
R9282:Fam186a UTSW 15 99,839,879 (GRCm39) missense probably damaging 0.97
R9514:Fam186a UTSW 15 99,844,766 (GRCm39) missense unknown
R9521:Fam186a UTSW 15 99,841,471 (GRCm39) missense probably damaging 0.97
R9553:Fam186a UTSW 15 99,844,561 (GRCm39) missense unknown
R9641:Fam186a UTSW 15 99,838,244 (GRCm39) missense probably benign 0.00
R9655:Fam186a UTSW 15 99,840,973 (GRCm39) missense probably damaging 0.99
R9661:Fam186a UTSW 15 99,842,492 (GRCm39) missense possibly damaging 0.66
R9673:Fam186a UTSW 15 99,841,024 (GRCm39) missense possibly damaging 0.90
R9762:Fam186a UTSW 15 99,842,393 (GRCm39) missense possibly damaging 0.66
X0021:Fam186a UTSW 15 99,843,316 (GRCm39) missense probably benign 0.00
Z1088:Fam186a UTSW 15 99,843,875 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TACTGAAGTCACCTTAGAAGTCTTGG -3'
(R):5'- AACTCAAAGGCCTGCCACTG -3'

Sequencing Primer
(F):5'- GGGTTGTAACTTACCAGACCG -3'
(R):5'- CCACTGACAGAGGAGACCTTG -3'
Posted On 2022-07-18