Incidental Mutation 'R9495:Hcls1'
ID 717190
Institutional Source Beutler Lab
Gene Symbol Hcls1
Ensembl Gene ENSMUSG00000022831
Gene Name hematopoietic cell specific Lyn substrate 1
Synonyms HS1
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.473) question?
Stock # R9495 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 36934983-36963212 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36957340 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 274 (M274L)
Ref Sequence ENSEMBL: ENSMUSP00000023531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023531] [ENSMUST00000164050]
AlphaFold P49710
Predicted Effect probably benign
Transcript: ENSMUST00000023531
AA Change: M274L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000023531
Gene: ENSMUSG00000022831
AA Change: M274L

DomainStartEndE-ValueType
Pfam:HS1_rep 82 117 6.6e-23 PFAM
Pfam:HS1_rep 119 154 1.2e-23 PFAM
Pfam:HS1_rep 156 191 3.3e-21 PFAM
Pfam:HS1_rep 193 220 2.1e-14 PFAM
coiled coil region 238 273 N/A INTRINSIC
low complexity region 358 390 N/A INTRINSIC
SH3 432 486 1.2e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164050
SMART Domains Protein: ENSMUSP00000127186
Gene: ENSMUSG00000022831

DomainStartEndE-ValueType
Pfam:HS1_rep 82 118 6e-24 PFAM
Pfam:HS1_rep 119 136 1.1e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene show impaired antibody production to T-independent antigen and impaired proliferative responses of splenic B and T cells after cross-linking of antigen receptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik C T 8: 45,956,421 S287N probably damaging Het
1700088E04Rik T A 15: 79,135,642 D158V probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Acp5 G A 9: 22,127,187 Q273* probably null Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Atp2b1 T A 10: 98,999,798 N468K probably damaging Het
Bphl A T 13: 34,050,329 I143L probably benign Het
C130079G13Rik T C 3: 59,932,693 I62T possibly damaging Het
Ccdc58 A G 16: 36,072,121 E12G probably benign Het
Cd33 A T 7: 43,532,726 H98Q probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Colec10 A G 15: 54,462,365 D197G probably damaging Het
Cpt1a T C 19: 3,383,795 M759T probably benign Het
Ctc1 A G 11: 69,022,767 Y165C probably damaging Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Dnah2 T C 11: 69,454,382 D2667G possibly damaging Het
Dok1 T C 6: 83,032,991 K46E probably damaging Het
Erv3 C A 2: 131,856,055 W128L possibly damaging Het
Fam186a A G 15: 99,946,885 S493P unknown Het
Fbn1 A T 2: 125,319,064 N2185K probably damaging Het
Figla A C 6: 86,020,707 H139P probably benign Het
Gemin4 A G 11: 76,210,923 L1004P probably damaging Het
Gm11937 T C 11: 99,609,820 T124A unknown Het
Gm17669 G T 18: 67,562,612 V76L probably benign Het
Gm8765 T A 13: 50,701,429 S368T possibly damaging Het
Hist2h2ab A G 3: 96,220,085 E57G probably damaging Het
Il17rc T C 6: 113,472,780 S116P probably damaging Het
Krt79 G A 15: 101,931,853 R303C probably damaging Het
Lamb2 C T 9: 108,480,807 T149I probably damaging Het
Lrrc41 T A 4: 116,075,609 probably null Het
Mga C A 2: 119,951,195 T2234K possibly damaging Het
Muc6 T A 7: 141,651,133 Q205L probably damaging Het
Nlrp9b A T 7: 20,026,537 K624N possibly damaging Het
Olfr463 C T 11: 87,893,256 V223M probably benign Het
Olfr49 T C 14: 54,282,680 T72A probably damaging Het
Olfr99 G T 17: 37,280,495 probably benign Het
Otud4 T C 8: 79,673,458 S934P probably damaging Het
Pcdha12 G T 18: 37,022,473 W748C probably damaging Het
Pdc T C 1: 150,333,168 I134T probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Pkn1 C T 8: 83,684,170 R276Q possibly damaging Het
Plin3 C A 17: 56,280,824 G297V probably benign Het
Podn C T 4: 108,018,909 V517I probably benign Het
Pomk T C 8: 25,983,316 D203G probably damaging Het
Ppil4 A G 10: 7,799,591 D168G probably damaging Het
Ptgr2 T C 12: 84,307,873 I276T probably benign Het
Ptk7 T A 17: 46,576,818 I563F possibly damaging Het
Rbm12 G T 2: 156,097,818 T178K unknown Het
Sctr T C 1: 120,031,673 probably null Het
Sh2b1 GGGACC GGGACCGGCTCAGCCACGTGGACC 7: 126,467,572 probably benign Het
Steap1 A T 5: 5,736,458 D326E probably damaging Het
Stra6 G A 9: 58,151,892 V513I probably benign Het
Tbx19 A G 1: 165,138,977 S443P unknown Het
Tcea3 T A 4: 136,264,574 C190S probably damaging Het
Tfr2 G A 5: 137,574,439 V171I probably benign Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem129 A G 5: 33,657,778 V17A probably benign Het
Tmem2 T A 19: 21,801,885 V353D probably damaging Het
Tmem87b T C 2: 128,818,433 L32P probably damaging Het
Tor1aip1 T A 1: 156,030,431 D205V probably damaging Het
Trim33 T C 3: 103,331,758 V684A probably benign Het
Triobp C T 15: 78,993,178 R1637C probably damaging Het
Uhrf1bp1 A G 17: 27,893,440 D1201G probably damaging Het
Ulbp1 C A 10: 7,456,371 M196I probably benign Het
Vash1 G A 12: 86,691,889 G370E probably damaging Het
Vmn2r23 A G 6: 123,712,713 T183A probably benign Het
Vta1 A G 10: 14,655,839 I264T probably benign Het
Zcchc8 A T 5: 123,700,570 M635K probably benign Het
Other mutations in Hcls1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Hcls1 APN 16 36956021 critical splice donor site probably null
IGL01022:Hcls1 APN 16 36951126 intron probably benign
IGL02838:Hcls1 APN 16 36962419 missense probably damaging 1.00
R0125:Hcls1 UTSW 16 36962163 missense probably benign 0.14
R0137:Hcls1 UTSW 16 36951174 missense probably damaging 0.99
R0230:Hcls1 UTSW 16 36937854 missense probably damaging 1.00
R0614:Hcls1 UTSW 16 36962625 missense probably damaging 1.00
R1897:Hcls1 UTSW 16 36962643 missense probably damaging 1.00
R2246:Hcls1 UTSW 16 36962622 missense probably damaging 0.97
R4037:Hcls1 UTSW 16 36956625 missense possibly damaging 0.74
R4397:Hcls1 UTSW 16 36937300 missense possibly damaging 0.50
R4777:Hcls1 UTSW 16 36955316 missense probably damaging 1.00
R4978:Hcls1 UTSW 16 36937860 missense probably damaging 1.00
R5432:Hcls1 UTSW 16 36961548 missense probably benign
R5811:Hcls1 UTSW 16 36957340 missense probably null
R6601:Hcls1 UTSW 16 36962386 missense probably benign 0.00
R7794:Hcls1 UTSW 16 36962064 missense probably damaging 1.00
R8040:Hcls1 UTSW 16 36951149 missense probably damaging 0.97
R8439:Hcls1 UTSW 16 36946641 missense probably benign 0.14
R8688:Hcls1 UTSW 16 36961459 missense probably benign
R8782:Hcls1 UTSW 16 36957301 missense probably benign
R9157:Hcls1 UTSW 16 36956638 missense probably benign 0.34
R9313:Hcls1 UTSW 16 36956638 missense probably benign 0.34
Z1176:Hcls1 UTSW 16 36961492 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCTGTATATCTAACAGATCTCGCTC -3'
(R):5'- AGAAATGCATCTGCCCTATCTATC -3'

Sequencing Primer
(F):5'- GATCTCGCTCATTTATACAAGTACC -3'
(R):5'- GCATCTGCCCTATCTATCTATCTATC -3'
Posted On 2022-07-18