Incidental Mutation 'R9495:Bltp3a'
ID 717191
Institutional Source Beutler Lab
Gene Symbol Bltp3a
Ensembl Gene ENSMUSG00000039512
Gene Name bridge-like lipid transfer protein family member 3A
Synonyms 1110020K19Rik, F830021D11Rik, Uhrf1bp1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9495 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 28075481-28119014 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 28112414 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1201 (D1201G)
Ref Sequence ENSEMBL: ENSMUSP00000110499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114849]
AlphaFold B2KF50
Predicted Effect probably damaging
Transcript: ENSMUST00000114849
AA Change: D1201G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110499
Gene: ENSMUSG00000039512
AA Change: D1201G

DomainStartEndE-ValueType
Pfam:Chorein_N 1 104 2.6e-18 PFAM
low complexity region 234 247 N/A INTRINSIC
low complexity region 297 306 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
low complexity region 1200 1216 N/A INTRINSIC
low complexity region 1322 1333 N/A INTRINSIC
low complexity region 1375 1386 N/A INTRINSIC
coiled coil region 1394 1424 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T A 15: 79,019,842 (GRCm39) D158V probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
Aadacl2fm1 T C 3: 59,840,114 (GRCm39) I62T possibly damaging Het
Acp5 G A 9: 22,038,483 (GRCm39) Q273* probably null Het
Apoa5 G C 9: 46,181,944 (GRCm39) R340P probably damaging Het
Atp2b1 T A 10: 98,835,660 (GRCm39) N468K probably damaging Het
Bphl A T 13: 34,234,312 (GRCm39) I143L probably benign Het
Cd33 A T 7: 43,182,150 (GRCm39) H98Q probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Cemip2 T A 19: 21,779,249 (GRCm39) V353D probably damaging Het
Cfap96 C T 8: 46,409,458 (GRCm39) S287N probably damaging Het
Colec10 A G 15: 54,325,761 (GRCm39) D197G probably damaging Het
Cpt1a T C 19: 3,433,795 (GRCm39) M759T probably benign Het
Ctc1 A G 11: 68,913,593 (GRCm39) Y165C probably damaging Het
Cyp2t4 G A 7: 26,854,717 (GRCm39) V66M possibly damaging Het
Dnah2 T C 11: 69,345,208 (GRCm39) D2667G possibly damaging Het
Dok1 T C 6: 83,009,972 (GRCm39) K46E probably damaging Het
Erv3 C A 2: 131,697,975 (GRCm39) W128L possibly damaging Het
Fam186a A G 15: 99,844,766 (GRCm39) S493P unknown Het
Fbn1 A T 2: 125,160,984 (GRCm39) N2185K probably damaging Het
Figla A C 6: 85,997,689 (GRCm39) H139P probably benign Het
Gemin4 A G 11: 76,101,749 (GRCm39) L1004P probably damaging Het
Gm11937 T C 11: 99,500,646 (GRCm39) T124A unknown Het
Gm17669 G T 18: 67,695,682 (GRCm39) V76L probably benign Het
H2ac21 A G 3: 96,127,401 (GRCm39) E57G probably damaging Het
Hcls1 A T 16: 36,777,702 (GRCm39) M274L probably benign Het
Il17rc T C 6: 113,449,741 (GRCm39) S116P probably damaging Het
Krt79 G A 15: 101,840,288 (GRCm39) R303C probably damaging Het
Lamb2 C T 9: 108,358,006 (GRCm39) T149I probably damaging Het
Lrrc41 T A 4: 115,932,806 (GRCm39) probably null Het
Mga C A 2: 119,781,676 (GRCm39) T2234K possibly damaging Het
Mix23 A G 16: 35,892,491 (GRCm39) E12G probably benign Het
Muc6 T A 7: 141,237,398 (GRCm39) Q205L probably damaging Het
Nlrp9b A T 7: 19,760,462 (GRCm39) K624N possibly damaging Het
Or1o4 G T 17: 37,591,386 (GRCm39) probably benign Het
Or4d2 C T 11: 87,784,082 (GRCm39) V223M probably benign Het
Or6e1 T C 14: 54,520,137 (GRCm39) T72A probably damaging Het
Otud4 T C 8: 80,400,087 (GRCm39) S934P probably damaging Het
Pcdha12 G T 18: 37,155,526 (GRCm39) W748C probably damaging Het
Pdc T C 1: 150,208,919 (GRCm39) I134T probably damaging Het
Peg10 T TCCC 6: 4,756,451 (GRCm39) probably benign Het
Pkn1 C T 8: 84,410,799 (GRCm39) R276Q possibly damaging Het
Plin3 C A 17: 56,587,824 (GRCm39) G297V probably benign Het
Podn C T 4: 107,876,106 (GRCm39) V517I probably benign Het
Pomk T C 8: 26,473,344 (GRCm39) D203G probably damaging Het
Ppil4 A G 10: 7,675,355 (GRCm39) D168G probably damaging Het
Ptgr2 T C 12: 84,354,647 (GRCm39) I276T probably benign Het
Ptk7 T A 17: 46,887,744 (GRCm39) I563F possibly damaging Het
Rbm12 G T 2: 155,939,738 (GRCm39) T178K unknown Het
Sctr T C 1: 119,959,403 (GRCm39) probably null Het
Sh2b1 GGGACC GGGACCGGCTCAGCCACGTGGACC 7: 126,066,744 (GRCm39) probably benign Het
Spata31e4 T A 13: 50,855,465 (GRCm39) S368T possibly damaging Het
Steap1 A T 5: 5,786,458 (GRCm39) D326E probably damaging Het
Stra6 G A 9: 58,059,175 (GRCm39) V513I probably benign Het
Tbx19 A G 1: 164,966,546 (GRCm39) S443P unknown Het
Tcea3 T A 4: 135,991,885 (GRCm39) C190S probably damaging Het
Tfr2 G A 5: 137,572,701 (GRCm39) V171I probably benign Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tmem129 A G 5: 33,815,122 (GRCm39) V17A probably benign Het
Tmem87b T C 2: 128,660,353 (GRCm39) L32P probably damaging Het
Tor1aip1 T A 1: 155,906,177 (GRCm39) D205V probably damaging Het
Trim33 T C 3: 103,239,074 (GRCm39) V684A probably benign Het
Triobp C T 15: 78,877,378 (GRCm39) R1637C probably damaging Het
Ulbp1 C A 10: 7,406,371 (GRCm39) M196I probably benign Het
Vash1 G A 12: 86,738,663 (GRCm39) G370E probably damaging Het
Vmn2r23 A G 6: 123,689,672 (GRCm39) T183A probably benign Het
Vta1 A G 10: 14,531,583 (GRCm39) I264T probably benign Het
Zcchc8 A T 5: 123,838,633 (GRCm39) M635K probably benign Het
Other mutations in Bltp3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Bltp3a APN 17 28,095,891 (GRCm39) splice site probably benign
IGL00786:Bltp3a APN 17 28,098,266 (GRCm39) missense probably damaging 0.99
IGL01074:Bltp3a APN 17 28,098,265 (GRCm39) missense possibly damaging 0.94
IGL01780:Bltp3a APN 17 28,112,474 (GRCm39) missense probably damaging 1.00
IGL02668:Bltp3a APN 17 28,105,549 (GRCm39) missense possibly damaging 0.53
IGL02686:Bltp3a APN 17 28,113,563 (GRCm39) missense probably benign
IGL03240:Bltp3a APN 17 28,112,227 (GRCm39) missense probably benign 0.37
hades UTSW 17 28,113,720 (GRCm39) missense probably damaging 1.00
R0167:Bltp3a UTSW 17 28,099,176 (GRCm39) missense possibly damaging 0.46
R0240:Bltp3a UTSW 17 28,114,844 (GRCm39) splice site probably benign
R0332:Bltp3a UTSW 17 28,112,268 (GRCm39) critical splice donor site probably null
R0668:Bltp3a UTSW 17 28,114,913 (GRCm39) missense probably benign 0.16
R0726:Bltp3a UTSW 17 28,104,463 (GRCm39) missense possibly damaging 0.50
R0964:Bltp3a UTSW 17 28,106,152 (GRCm39) missense probably damaging 0.96
R1125:Bltp3a UTSW 17 28,112,423 (GRCm39) missense probably damaging 1.00
R1139:Bltp3a UTSW 17 28,109,045 (GRCm39) missense possibly damaging 0.87
R1164:Bltp3a UTSW 17 28,114,354 (GRCm39) critical splice donor site probably null
R1192:Bltp3a UTSW 17 28,109,045 (GRCm39) missense possibly damaging 0.87
R1277:Bltp3a UTSW 17 28,109,045 (GRCm39) missense possibly damaging 0.87
R1279:Bltp3a UTSW 17 28,109,045 (GRCm39) missense possibly damaging 0.87
R1340:Bltp3a UTSW 17 28,113,695 (GRCm39) missense probably benign 0.00
R1341:Bltp3a UTSW 17 28,096,393 (GRCm39) splice site probably benign
R1344:Bltp3a UTSW 17 28,113,551 (GRCm39) missense probably benign 0.41
R1418:Bltp3a UTSW 17 28,113,551 (GRCm39) missense probably benign 0.41
R1552:Bltp3a UTSW 17 28,109,045 (GRCm39) missense possibly damaging 0.87
R1726:Bltp3a UTSW 17 28,105,225 (GRCm39) splice site probably null
R1791:Bltp3a UTSW 17 28,113,720 (GRCm39) missense probably damaging 1.00
R1796:Bltp3a UTSW 17 28,109,045 (GRCm39) missense possibly damaging 0.87
R2858:Bltp3a UTSW 17 28,104,436 (GRCm39) missense probably damaging 0.99
R3034:Bltp3a UTSW 17 28,113,720 (GRCm39) missense probably damaging 1.00
R4111:Bltp3a UTSW 17 28,105,064 (GRCm39) nonsense probably null
R4159:Bltp3a UTSW 17 28,103,061 (GRCm39) missense probably damaging 1.00
R4160:Bltp3a UTSW 17 28,103,061 (GRCm39) missense probably damaging 1.00
R4161:Bltp3a UTSW 17 28,103,061 (GRCm39) missense probably damaging 1.00
R4431:Bltp3a UTSW 17 28,104,905 (GRCm39) missense probably damaging 1.00
R4575:Bltp3a UTSW 17 28,106,477 (GRCm39) missense probably benign 0.02
R4657:Bltp3a UTSW 17 28,109,079 (GRCm39) missense probably benign 0.09
R4666:Bltp3a UTSW 17 28,112,477 (GRCm39) missense possibly damaging 0.95
R4825:Bltp3a UTSW 17 28,096,368 (GRCm39) missense probably damaging 0.98
R4872:Bltp3a UTSW 17 28,109,110 (GRCm39) missense probably benign 0.10
R4956:Bltp3a UTSW 17 28,108,958 (GRCm39) splice site probably null
R4976:Bltp3a UTSW 17 28,103,000 (GRCm39) missense probably damaging 0.99
R4982:Bltp3a UTSW 17 28,105,580 (GRCm39) missense probably benign 0.05
R5017:Bltp3a UTSW 17 28,113,713 (GRCm39) nonsense probably null
R5033:Bltp3a UTSW 17 28,105,838 (GRCm39) missense probably damaging 0.99
R5137:Bltp3a UTSW 17 28,095,964 (GRCm39) splice site probably null
R5159:Bltp3a UTSW 17 28,100,530 (GRCm39) missense probably damaging 0.98
R5177:Bltp3a UTSW 17 28,103,992 (GRCm39) missense possibly damaging 0.94
R5196:Bltp3a UTSW 17 28,075,737 (GRCm39) missense probably benign 0.09
R5214:Bltp3a UTSW 17 28,106,489 (GRCm39) missense probably benign
R5352:Bltp3a UTSW 17 28,106,489 (GRCm39) missense probably benign
R5354:Bltp3a UTSW 17 28,106,489 (GRCm39) missense probably benign
R5425:Bltp3a UTSW 17 28,106,489 (GRCm39) missense probably benign
R5601:Bltp3a UTSW 17 28,103,468 (GRCm39) missense probably damaging 1.00
R6080:Bltp3a UTSW 17 28,099,271 (GRCm39) missense probably benign
R6088:Bltp3a UTSW 17 28,103,579 (GRCm39) critical splice donor site probably null
R6331:Bltp3a UTSW 17 28,112,175 (GRCm39) missense probably benign 0.01
R6529:Bltp3a UTSW 17 28,098,750 (GRCm39) missense possibly damaging 0.90
R6614:Bltp3a UTSW 17 28,095,899 (GRCm39) missense probably benign 0.18
R6701:Bltp3a UTSW 17 28,106,331 (GRCm39) nonsense probably null
R7082:Bltp3a UTSW 17 28,109,039 (GRCm39) missense probably damaging 1.00
R7158:Bltp3a UTSW 17 28,105,407 (GRCm39) nonsense probably null
R8338:Bltp3a UTSW 17 28,095,669 (GRCm39) missense probably damaging 1.00
R8914:Bltp3a UTSW 17 28,105,887 (GRCm39) missense possibly damaging 0.66
R9135:Bltp3a UTSW 17 28,104,902 (GRCm39) nonsense probably null
R9218:Bltp3a UTSW 17 28,114,529 (GRCm39) missense probably benign 0.00
R9421:Bltp3a UTSW 17 28,095,660 (GRCm39) missense probably damaging 1.00
R9514:Bltp3a UTSW 17 28,112,414 (GRCm39) missense probably damaging 1.00
R9621:Bltp3a UTSW 17 28,105,753 (GRCm39) missense probably benign 0.00
R9766:Bltp3a UTSW 17 28,105,799 (GRCm39) missense probably damaging 1.00
RF005:Bltp3a UTSW 17 28,104,505 (GRCm39) missense probably damaging 1.00
X0017:Bltp3a UTSW 17 28,096,315 (GRCm39) missense probably benign 0.03
Z1176:Bltp3a UTSW 17 28,105,280 (GRCm39) missense probably damaging 1.00
Z1176:Bltp3a UTSW 17 28,095,650 (GRCm39) missense probably damaging 1.00
Z1177:Bltp3a UTSW 17 28,103,940 (GRCm39) missense not run
Predicted Primers
Posted On 2022-07-18