Incidental Mutation 'R9497:Cr2'
ID 717256
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Name complement receptor 2
Synonyms C3DR, CD21, Cr-2, Cr1, Cr-1, CD35
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R9497 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 194819119-194859024 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 194850743 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 241 (V241A)
Ref Sequence ENSEMBL: ENSMUSP00000147804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043104] [ENSMUST00000082321] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000043104
AA Change: V221A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044261
Gene: ENSMUSG00000026616
AA Change: V221A

DomainStartEndE-ValueType
CCP 2 58 5.04e-7 SMART
CCP 63 120 3.58e-12 SMART
CCP 125 191 1.2e-13 SMART
CCP 197 252 2.73e-17 SMART
CCP 256 311 1.01e-15 SMART
Blast:CCP 316 347 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000082321
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195120
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000210219
AA Change: V241A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik A C 1: 85,973,893 (GRCm39) E70A possibly damaging Het
Abcb5 C A 12: 118,899,850 (GRCm39) Q272H probably damaging Het
Acoxl T C 2: 127,719,706 (GRCm39) Y156H probably damaging Het
Alg9 T C 9: 50,711,436 (GRCm39) F305L probably damaging Het
Apobec4 T C 1: 152,632,947 (GRCm39) V325A probably benign Het
Aqp9 T G 9: 71,069,651 (GRCm39) D46A probably benign Het
Atp13a4 T A 16: 29,288,130 (GRCm39) probably null Het
BC051019 A G 7: 109,315,466 (GRCm39) F263S probably damaging Het
Bicc1 A T 10: 70,776,828 (GRCm39) probably null Het
Birc2 G A 9: 7,861,028 (GRCm39) Q97* probably null Het
Capn13 G T 17: 73,633,362 (GRCm39) T533N probably benign Het
Casp6 G A 3: 129,699,559 (GRCm39) V13M probably benign Het
Cdh10 A T 15: 18,964,267 (GRCm39) E143V probably damaging Het
Cobl T A 11: 12,203,501 (GRCm39) Q1067L probably benign Het
Cyp2c23 C T 19: 44,010,085 (GRCm39) V87M probably damaging Het
Cyp2j9 G A 4: 96,460,211 (GRCm39) Q431* probably null Het
Cyp2t4 G A 7: 26,854,717 (GRCm39) V66M possibly damaging Het
Cyp4a12b A T 4: 115,271,768 (GRCm39) M160L probably benign Het
Ddhd2 T A 8: 26,217,731 (GRCm39) K715N possibly damaging Het
Ecscr T C 18: 35,851,436 (GRCm39) Y32C probably damaging Het
Ednra A T 8: 78,446,934 (GRCm39) L48Q probably benign Het
Eya4 C T 10: 22,987,458 (GRCm39) probably null Het
F13a1 C A 13: 37,082,118 (GRCm39) V529L probably benign Het
Fam151b A T 13: 92,610,621 (GRCm39) I56K probably damaging Het
Fat3 A G 9: 15,903,504 (GRCm39) I2997T probably damaging Het
Fgfr2 A T 7: 129,765,763 (GRCm39) F817I probably damaging Het
Fras1 G T 5: 96,884,895 (GRCm39) C2591F probably damaging Het
Fryl T C 5: 73,215,134 (GRCm39) D2214G Het
Galntl6 A T 8: 58,290,410 (GRCm39) D394E probably damaging Het
Ggcx C A 6: 72,406,190 (GRCm39) N605K probably damaging Het
Gja5 A G 3: 96,958,801 (GRCm39) N286S Het
Gm4553 A T 7: 141,719,298 (GRCm39) C43* probably null Het
Gpr158 T C 2: 21,831,825 (GRCm39) V975A probably benign Het
Greb1l T A 18: 10,458,600 (GRCm39) D60E probably benign Het
Hao2 A T 3: 98,784,462 (GRCm39) L301H probably damaging Het
Hic1 A G 11: 75,060,131 (GRCm39) L72P possibly damaging Het
Hs3st5 A C 10: 36,709,370 (GRCm39) N302H probably benign Het
Htr1d A G 4: 136,169,663 (GRCm39) probably benign Het
Inka1 A G 9: 107,861,938 (GRCm39) V128A probably benign Het
Kdm7a T C 6: 39,128,253 (GRCm39) D526G probably damaging Het
Kif5a T C 10: 127,079,353 (GRCm39) S282G probably damaging Het
Klhdc7b T C 15: 89,272,463 (GRCm39) V457A possibly damaging Het
Lcorl A G 5: 45,891,339 (GRCm39) V421A probably benign Het
Ltc4s A G 11: 50,127,386 (GRCm39) S150P unknown Het
Mdfic C T 6: 15,720,852 (GRCm39) R18W unknown Het
Mdfic T G 6: 15,770,508 (GRCm39) D171E probably benign Het
Meis2 T C 2: 115,694,724 (GRCm39) D473G possibly damaging Het
Mettl17 A T 14: 52,129,029 (GRCm39) Q433L unknown Het
Mettl25 T C 10: 105,677,090 (GRCm39) R31G probably damaging Het
Mroh2b T A 15: 4,950,845 (GRCm39) I581N probably damaging Het
Myh7 A T 14: 55,217,841 (GRCm39) N1091K probably benign Het
Mysm1 T C 4: 94,848,635 (GRCm39) D466G probably benign Het
Ncoa6 T C 2: 155,248,238 (GRCm39) T1689A probably damaging Het
Ndfip2 A G 14: 105,542,245 (GRCm39) T332A probably benign Het
Nfkbil1 G A 17: 35,439,605 (GRCm39) P303S probably damaging Het
Nfx1 T G 4: 40,994,104 (GRCm39) N604K probably benign Het
Npb T C 11: 120,499,473 (GRCm39) F47L probably benign Het
Nr2c2 C T 6: 92,133,673 (GRCm39) T259I possibly damaging Het
Nt5el G T 13: 105,236,987 (GRCm39) L79F probably damaging Het
Obsl1 C T 1: 75,467,484 (GRCm39) C1430Y probably damaging Het
Or10al5 T A 17: 38,062,942 (GRCm39) Y66N probably damaging Het
Or10b1 A G 10: 78,355,738 (GRCm39) I99V probably benign Het
Or10g6 A T 9: 39,934,616 (GRCm39) H309L probably benign Het
Or4d5 G A 9: 40,011,935 (GRCm39) P284S probably damaging Het
Or4n4b C T 14: 50,536,362 (GRCm39) V135I probably benign Het
Or6c202 C A 10: 128,996,464 (GRCm39) V130L probably benign Het
Or6f1 G A 7: 85,970,989 (GRCm39) T57M probably damaging Het
Pdcd6 A T 13: 74,453,695 (GRCm39) F148I probably damaging Het
Pih1d1 A T 7: 44,803,789 (GRCm39) Q16L unknown Het
Ppp1r10 T C 17: 36,235,786 (GRCm39) S123P probably damaging Het
Ppp1r13b A T 12: 111,807,446 (GRCm39) M305K probably benign Het
Prg2 A G 2: 84,811,685 (GRCm39) K2E possibly damaging Het
Prkd1 A T 12: 50,438,107 (GRCm39) probably null Het
Rfx7 T A 9: 72,526,423 (GRCm39) H1204Q probably benign Het
Serpina3k A C 12: 104,309,430 (GRCm39) Q291H probably benign Het
Tafa4 T A 6: 96,820,831 (GRCm39) I93F possibly damaging Het
Tas2r107 G T 6: 131,636,549 (GRCm39) Q167K probably benign Het
Tle1 A C 4: 72,071,135 (GRCm39) probably benign Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Trpa1 C T 1: 14,989,026 (GRCm39) E12K probably benign Het
Vmn2r7 T C 3: 64,614,474 (GRCm39) T447A probably benign Het
Wdr86 T C 5: 24,920,538 (GRCm39) Y283C probably benign Het
Zfp329 A T 7: 12,544,215 (GRCm39) Y436* probably null Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 194,836,559 (GRCm39) missense possibly damaging 0.76
IGL01326:Cr2 APN 1 194,823,529 (GRCm39) missense probably null 1.00
IGL01358:Cr2 APN 1 194,842,128 (GRCm39) missense probably damaging 1.00
IGL01410:Cr2 APN 1 194,845,542 (GRCm39) missense possibly damaging 0.49
IGL01468:Cr2 APN 1 194,850,843 (GRCm39) missense probably damaging 1.00
IGL01608:Cr2 APN 1 194,837,528 (GRCm39) missense possibly damaging 0.50
IGL01810:Cr2 APN 1 194,841,903 (GRCm39) missense possibly damaging 0.49
IGL01843:Cr2 APN 1 194,833,222 (GRCm39) splice site probably benign
IGL02332:Cr2 APN 1 194,842,630 (GRCm39) missense probably benign 0.19
IGL02934:Cr2 APN 1 194,836,633 (GRCm39) splice site probably benign
IGL02938:Cr2 APN 1 194,848,696 (GRCm39) missense probably damaging 1.00
IGL03149:Cr2 APN 1 194,848,674 (GRCm39) missense probably damaging 1.00
IGL03327:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
IGL03346:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
Pillar UTSW 1 194,838,196 (GRCm39) nonsense probably null
PIT4354001:Cr2 UTSW 1 194,848,617 (GRCm39) missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 194,839,760 (GRCm39) missense probably benign 0.08
R0128:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0130:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0380:Cr2 UTSW 1 194,839,715 (GRCm39) missense probably damaging 1.00
R0538:Cr2 UTSW 1 194,842,667 (GRCm39) splice site probably benign
R0605:Cr2 UTSW 1 194,845,904 (GRCm39) splice site probably benign
R0626:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.95
R1135:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R1396:Cr2 UTSW 1 194,851,561 (GRCm39) splice site probably null
R1422:Cr2 UTSW 1 194,853,433 (GRCm39) missense probably benign 0.01
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1511:Cr2 UTSW 1 194,837,580 (GRCm39) missense possibly damaging 0.92
R1572:Cr2 UTSW 1 194,845,622 (GRCm39) missense probably damaging 1.00
R1714:Cr2 UTSW 1 194,833,994 (GRCm39) missense possibly damaging 0.46
R1748:Cr2 UTSW 1 194,838,213 (GRCm39) nonsense probably null
R1761:Cr2 UTSW 1 194,837,431 (GRCm39) critical splice donor site probably null
R1824:Cr2 UTSW 1 194,839,624 (GRCm39) missense probably damaging 1.00
R1893:Cr2 UTSW 1 194,837,495 (GRCm39) missense probably benign 0.03
R1990:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1991:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1992:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R2191:Cr2 UTSW 1 194,845,689 (GRCm39) missense possibly damaging 0.94
R2276:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R2277:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R3548:Cr2 UTSW 1 194,838,196 (GRCm39) nonsense probably null
R3743:Cr2 UTSW 1 194,832,274 (GRCm39) splice site probably benign
R3941:Cr2 UTSW 1 194,848,122 (GRCm39) missense probably damaging 0.97
R3963:Cr2 UTSW 1 194,842,047 (GRCm39) missense probably damaging 1.00
R4211:Cr2 UTSW 1 194,838,636 (GRCm39) missense probably damaging 0.96
R4484:Cr2 UTSW 1 194,836,482 (GRCm39) missense probably damaging 1.00
R4546:Cr2 UTSW 1 194,853,349 (GRCm39) missense possibly damaging 0.94
R4791:Cr2 UTSW 1 194,838,243 (GRCm39) missense probably damaging 1.00
R4801:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4802:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4874:Cr2 UTSW 1 194,858,878 (GRCm39) missense possibly damaging 0.82
R4885:Cr2 UTSW 1 194,841,039 (GRCm39) missense possibly damaging 0.92
R4889:Cr2 UTSW 1 194,858,893 (GRCm39) missense possibly damaging 0.70
R5154:Cr2 UTSW 1 194,841,754 (GRCm39) missense probably damaging 1.00
R5574:Cr2 UTSW 1 194,823,544 (GRCm39) missense probably damaging 1.00
R5594:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R5645:Cr2 UTSW 1 194,836,581 (GRCm39) missense probably damaging 1.00
R5700:Cr2 UTSW 1 194,842,065 (GRCm39) missense probably damaging 0.96
R5929:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.91
R6237:Cr2 UTSW 1 194,839,810 (GRCm39) missense probably damaging 1.00
R6299:Cr2 UTSW 1 194,850,954 (GRCm39) missense probably damaging 1.00
R6368:Cr2 UTSW 1 194,850,780 (GRCm39) missense probably damaging 1.00
R6406:Cr2 UTSW 1 194,852,079 (GRCm39) missense probably damaging 1.00
R6618:Cr2 UTSW 1 194,839,687 (GRCm39) missense probably damaging 0.98
R6684:Cr2 UTSW 1 194,853,329 (GRCm39) nonsense probably null
R6720:Cr2 UTSW 1 194,837,508 (GRCm39) missense probably damaging 0.97
R6866:Cr2 UTSW 1 194,833,999 (GRCm39) missense probably damaging 1.00
R6915:Cr2 UTSW 1 194,853,454 (GRCm39) missense probably benign 0.06
R7057:Cr2 UTSW 1 194,833,918 (GRCm39) missense possibly damaging 0.83
R7117:Cr2 UTSW 1 194,842,909 (GRCm39) missense possibly damaging 0.79
R7200:Cr2 UTSW 1 194,845,557 (GRCm39) missense probably damaging 1.00
R7209:Cr2 UTSW 1 194,851,032 (GRCm39) missense probably damaging 1.00
R7350:Cr2 UTSW 1 194,837,594 (GRCm39) missense probably benign 0.21
R7414:Cr2 UTSW 1 194,832,344 (GRCm39) missense probably benign
R7453:Cr2 UTSW 1 194,847,565 (GRCm39) splice site probably null
R7479:Cr2 UTSW 1 194,840,718 (GRCm39) critical splice donor site probably null
R7480:Cr2 UTSW 1 194,836,484 (GRCm39) missense probably damaging 1.00
R7570:Cr2 UTSW 1 194,851,648 (GRCm39) nonsense probably null
R7666:Cr2 UTSW 1 194,836,533 (GRCm39) missense probably damaging 1.00
R7921:Cr2 UTSW 1 194,833,975 (GRCm39) missense possibly damaging 0.94
R7923:Cr2 UTSW 1 194,850,995 (GRCm39) missense probably benign 0.03
R8396:Cr2 UTSW 1 194,840,376 (GRCm39) missense probably damaging 1.00
R8503:Cr2 UTSW 1 194,845,850 (GRCm39) missense probably benign
R8517:Cr2 UTSW 1 194,838,207 (GRCm39) missense probably benign 0.03
R8773:Cr2 UTSW 1 194,840,913 (GRCm39) missense probably damaging 1.00
R8849:Cr2 UTSW 1 194,839,547 (GRCm39) missense probably damaging 1.00
R8896:Cr2 UTSW 1 194,851,581 (GRCm39) missense possibly damaging 0.58
R8938:Cr2 UTSW 1 194,853,424 (GRCm39) missense probably damaging 0.99
R9027:Cr2 UTSW 1 194,834,029 (GRCm39) missense probably benign 0.08
R9045:Cr2 UTSW 1 194,837,680 (GRCm39) missense possibly damaging 0.61
R9116:Cr2 UTSW 1 194,840,977 (GRCm39) nonsense probably null
R9137:Cr2 UTSW 1 194,850,640 (GRCm39) critical splice donor site probably null
R9476:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9510:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9752:Cr2 UTSW 1 194,823,575 (GRCm39) missense probably benign 0.37
R9799:Cr2 UTSW 1 194,842,988 (GRCm39) missense probably benign 0.02
X0028:Cr2 UTSW 1 194,832,290 (GRCm39) missense probably benign 0.09
X0066:Cr2 UTSW 1 194,848,629 (GRCm39) missense probably damaging 0.99
Z1176:Cr2 UTSW 1 194,836,461 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GGTACCATGTGTCTATTCTGAAGAAC -3'
(R):5'- GAGACTTCTACAGCAGCAGC -3'

Sequencing Primer
(F):5'- CAATGGAGGGCTCCATTT -3'
(R):5'- GCAGCAGAGACAGCTTTTTC -3'
Posted On 2022-07-18