Incidental Mutation 'R9497:Cr2'
ID 717256
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Name complement receptor 2
Synonyms C3DR, CD21, Cr-1, Cr1, CD35, Cr-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock # R9497 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 195136811-195176716 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 195168435 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 241 (V241A)
Ref Sequence ENSEMBL: ENSMUSP00000147804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043104] [ENSMUST00000082321] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000043104
AA Change: V221A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044261
Gene: ENSMUSG00000026616
AA Change: V221A

DomainStartEndE-ValueType
CCP 2 58 5.04e-7 SMART
CCP 63 120 3.58e-12 SMART
CCP 125 191 1.2e-13 SMART
CCP 197 252 2.73e-17 SMART
CCP 256 311 1.01e-15 SMART
Blast:CCP 316 347 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000082321
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195120
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000210219
AA Change: V241A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik A C 1: 86,046,171 E70A possibly damaging Het
4933425L06Rik G T 13: 105,100,479 L79F probably damaging Het
Abcb5 C A 12: 118,936,115 Q272H probably damaging Het
Acoxl T C 2: 127,877,786 Y156H probably damaging Het
Alg9 T C 9: 50,800,136 F305L probably damaging Het
Apobec4 T C 1: 152,757,196 V325A probably benign Het
Aqp9 T G 9: 71,162,369 D46A probably benign Het
Atp13a4 T A 16: 29,469,312 probably null Het
BC051019 A G 7: 109,716,259 F263S probably damaging Het
Bicc1 A T 10: 70,940,998 probably null Het
Birc3 G A 9: 7,861,027 Q97* probably null Het
Capn13 G T 17: 73,326,367 T533N probably benign Het
Casp6 G A 3: 129,905,910 V13M probably benign Het
Cdh10 A T 15: 18,964,181 E143V probably damaging Het
Cobl T A 11: 12,253,501 Q1067L probably benign Het
Cyp2c23 C T 19: 44,021,646 V87M probably damaging Het
Cyp2j9 G A 4: 96,571,974 Q431* probably null Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Cyp4a12b A T 4: 115,414,571 M160L probably benign Het
Ddhd2 T A 8: 25,727,704 K715N possibly damaging Het
Ecscr T C 18: 35,718,383 Y32C probably damaging Het
Ednra A T 8: 77,720,305 L48Q probably benign Het
Eya4 C T 10: 23,111,559 probably null Het
F13a1 C A 13: 36,898,144 V529L probably benign Het
Fam151b A T 13: 92,474,113 I56K probably damaging Het
Fam19a4 T A 6: 96,843,870 I93F possibly damaging Het
Fam212a A G 9: 107,984,739 V128A probably benign Het
Fat3 A G 9: 15,992,208 I2997T probably damaging Het
Fgfr2 A T 7: 130,164,033 F817I probably damaging Het
Fras1 G T 5: 96,737,036 C2591F probably damaging Het
Fryl T C 5: 73,057,791 D2214G Het
Galntl6 A T 8: 57,837,376 D394E probably damaging Het
Ggcx C A 6: 72,429,207 N605K probably damaging Het
Gja5 A G 3: 97,051,485 N286S Het
Gm4553 A T 7: 142,165,561 C43* probably null Het
Gpr158 T C 2: 21,827,014 V975A probably benign Het
Greb1l T A 18: 10,458,600 D60E probably benign Het
Hao2 A T 3: 98,877,146 L301H probably damaging Het
Hic1 A G 11: 75,169,305 L72P possibly damaging Het
Hs3st5 A C 10: 36,833,374 N302H probably benign Het
Htr1d A G 4: 136,442,352 probably benign Het
Kdm7a T C 6: 39,151,319 D526G probably damaging Het
Kif5a T C 10: 127,243,484 S282G probably damaging Het
Klhdc7b T C 15: 89,388,260 V457A possibly damaging Het
Lcorl A G 5: 45,733,997 V421A probably benign Het
Ltc4s A G 11: 50,236,559 S150P unknown Het
Mdfic C T 6: 15,720,853 R18W unknown Het
Mdfic T G 6: 15,770,509 D171E probably benign Het
Meis2 T C 2: 115,864,243 D473G possibly damaging Het
Mettl17 A T 14: 51,891,572 Q433L unknown Het
Mettl25 T C 10: 105,841,229 R31G probably damaging Het
Mroh2b T A 15: 4,921,363 I581N probably damaging Het
Myh7 A T 14: 54,980,384 N1091K probably benign Het
Mysm1 T C 4: 94,960,398 D466G probably benign Het
Ncoa6 T C 2: 155,406,318 T1689A probably damaging Het
Ndfip2 A G 14: 105,304,811 T332A probably benign Het
Nfkbil1 G A 17: 35,220,629 P303S probably damaging Het
Nfx1 T G 4: 40,994,104 N604K probably benign Het
Npb T C 11: 120,608,647 F47L probably benign Het
Nr2c2 C T 6: 92,156,692 T259I possibly damaging Het
Obsl1 C T 1: 75,490,840 C1430Y probably damaging Het
Olfr121 T A 17: 37,752,051 Y66N probably damaging Het
Olfr1358 A G 10: 78,519,904 I99V probably benign Het
Olfr308 G A 7: 86,321,781 T57M probably damaging Het
Olfr733 C T 14: 50,298,905 V135I probably benign Het
Olfr771 C A 10: 129,160,595 V130L probably benign Het
Olfr981 A T 9: 40,023,320 H309L probably benign Het
Olfr984 G A 9: 40,100,639 P284S probably damaging Het
Pdcd6 A T 13: 74,305,576 F148I probably damaging Het
Pih1d1 A T 7: 45,154,365 Q16L unknown Het
Ppp1r10 T C 17: 35,924,894 S123P probably damaging Het
Ppp1r13b A T 12: 111,841,012 M305K probably benign Het
Prg2 A G 2: 84,981,341 K2E possibly damaging Het
Prkd1 A T 12: 50,391,324 probably null Het
Rfx7 T A 9: 72,619,141 H1204Q probably benign Het
Serpina3k A C 12: 104,343,171 Q291H probably benign Het
Tas2r107 G T 6: 131,659,586 Q167K probably benign Het
Tle1 A C 4: 72,152,898 probably benign Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Trpa1 C T 1: 14,918,802 E12K probably benign Het
Vmn2r7 T C 3: 64,707,053 T447A probably benign Het
Wdr86 T C 5: 24,715,540 Y283C probably benign Het
Zfp329 A T 7: 12,810,288 Y436* probably null Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 195154251 missense possibly damaging 0.76
IGL01326:Cr2 APN 1 195141221 missense probably null 1.00
IGL01358:Cr2 APN 1 195159820 missense probably damaging 1.00
IGL01410:Cr2 APN 1 195163234 missense possibly damaging 0.49
IGL01468:Cr2 APN 1 195168535 missense probably damaging 1.00
IGL01608:Cr2 APN 1 195155220 missense possibly damaging 0.50
IGL01810:Cr2 APN 1 195159595 missense possibly damaging 0.49
IGL01843:Cr2 APN 1 195150914 splice site probably benign
IGL02332:Cr2 APN 1 195160322 missense probably benign 0.19
IGL02934:Cr2 APN 1 195154325 splice site probably benign
IGL02938:Cr2 APN 1 195166388 missense probably damaging 1.00
IGL03149:Cr2 APN 1 195166366 missense probably damaging 1.00
IGL03327:Cr2 APN 1 195169759 missense probably damaging 1.00
IGL03346:Cr2 APN 1 195169759 missense probably damaging 1.00
Pillar UTSW 1 195155888 nonsense probably null
PIT4354001:Cr2 UTSW 1 195166309 missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 195157452 missense probably benign 0.08
R0128:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0130:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0380:Cr2 UTSW 1 195157407 missense probably damaging 1.00
R0538:Cr2 UTSW 1 195160359 splice site probably benign
R0605:Cr2 UTSW 1 195163596 splice site probably benign
R0626:Cr2 UTSW 1 195171111 missense possibly damaging 0.95
R1135:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R1396:Cr2 UTSW 1 195169253 splice site probably null
R1422:Cr2 UTSW 1 195171125 missense probably benign 0.01
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1511:Cr2 UTSW 1 195155272 missense possibly damaging 0.92
R1572:Cr2 UTSW 1 195163314 missense probably damaging 1.00
R1714:Cr2 UTSW 1 195151686 missense possibly damaging 0.46
R1748:Cr2 UTSW 1 195155905 nonsense probably null
R1761:Cr2 UTSW 1 195155123 critical splice donor site probably null
R1824:Cr2 UTSW 1 195157316 missense probably damaging 1.00
R1893:Cr2 UTSW 1 195155187 missense probably benign 0.03
R1990:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1991:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1992:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R2191:Cr2 UTSW 1 195163381 missense possibly damaging 0.94
R2276:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R2277:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R3548:Cr2 UTSW 1 195155888 nonsense probably null
R3743:Cr2 UTSW 1 195149966 splice site probably benign
R3941:Cr2 UTSW 1 195165814 missense probably damaging 0.97
R3963:Cr2 UTSW 1 195159739 missense probably damaging 1.00
R4211:Cr2 UTSW 1 195156328 missense probably damaging 0.96
R4484:Cr2 UTSW 1 195154174 missense probably damaging 1.00
R4546:Cr2 UTSW 1 195171041 missense possibly damaging 0.94
R4791:Cr2 UTSW 1 195155935 missense probably damaging 1.00
R4801:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4802:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4874:Cr2 UTSW 1 195176570 missense possibly damaging 0.82
R4885:Cr2 UTSW 1 195158731 missense possibly damaging 0.92
R4889:Cr2 UTSW 1 195176585 missense possibly damaging 0.70
R5154:Cr2 UTSW 1 195159446 missense probably damaging 1.00
R5574:Cr2 UTSW 1 195141236 missense probably damaging 1.00
R5594:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R5645:Cr2 UTSW 1 195154273 missense probably damaging 1.00
R5700:Cr2 UTSW 1 195159757 missense probably damaging 0.96
R5929:Cr2 UTSW 1 195171111 missense possibly damaging 0.91
R6237:Cr2 UTSW 1 195157502 missense probably damaging 1.00
R6299:Cr2 UTSW 1 195168646 missense probably damaging 1.00
R6368:Cr2 UTSW 1 195168472 missense probably damaging 1.00
R6406:Cr2 UTSW 1 195169771 missense probably damaging 1.00
R6618:Cr2 UTSW 1 195157379 missense probably damaging 0.98
R6684:Cr2 UTSW 1 195171021 nonsense probably null
R6720:Cr2 UTSW 1 195155200 missense probably damaging 0.97
R6866:Cr2 UTSW 1 195151691 missense probably damaging 1.00
R6915:Cr2 UTSW 1 195171146 missense probably benign 0.06
R7057:Cr2 UTSW 1 195151610 missense possibly damaging 0.83
R7117:Cr2 UTSW 1 195160601 missense possibly damaging 0.79
R7200:Cr2 UTSW 1 195163249 missense probably damaging 1.00
R7209:Cr2 UTSW 1 195168724 missense probably damaging 1.00
R7350:Cr2 UTSW 1 195155286 missense probably benign 0.21
R7414:Cr2 UTSW 1 195150036 missense probably benign
R7453:Cr2 UTSW 1 195165257 splice site probably null
R7479:Cr2 UTSW 1 195158410 critical splice donor site probably null
R7480:Cr2 UTSW 1 195154176 missense probably damaging 1.00
R7570:Cr2 UTSW 1 195169340 nonsense probably null
R7666:Cr2 UTSW 1 195154225 missense probably damaging 1.00
R7921:Cr2 UTSW 1 195151667 missense possibly damaging 0.94
R7923:Cr2 UTSW 1 195168687 missense probably benign 0.03
R8396:Cr2 UTSW 1 195158068 missense probably damaging 1.00
R8503:Cr2 UTSW 1 195163542 missense probably benign
R8517:Cr2 UTSW 1 195155899 missense probably benign 0.03
R8773:Cr2 UTSW 1 195158605 missense probably damaging 1.00
R8849:Cr2 UTSW 1 195157239 missense probably damaging 1.00
R8896:Cr2 UTSW 1 195169273 missense possibly damaging 0.58
R8938:Cr2 UTSW 1 195171116 missense probably damaging 0.99
R9027:Cr2 UTSW 1 195151721 missense probably benign 0.08
R9045:Cr2 UTSW 1 195155372 missense possibly damaging 0.61
R9116:Cr2 UTSW 1 195158669 nonsense probably null
R9137:Cr2 UTSW 1 195168332 critical splice donor site probably null
R9476:Cr2 UTSW 1 195158108 missense probably damaging 0.97
R9510:Cr2 UTSW 1 195158108 missense probably damaging 0.97
R9752:Cr2 UTSW 1 195141267 missense probably benign 0.37
R9799:Cr2 UTSW 1 195160680 missense probably benign 0.02
X0028:Cr2 UTSW 1 195149982 missense probably benign 0.09
X0066:Cr2 UTSW 1 195166321 missense probably damaging 0.99
Z1176:Cr2 UTSW 1 195154153 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GGTACCATGTGTCTATTCTGAAGAAC -3'
(R):5'- GAGACTTCTACAGCAGCAGC -3'

Sequencing Primer
(F):5'- CAATGGAGGGCTCCATTT -3'
(R):5'- GCAGCAGAGACAGCTTTTTC -3'
Posted On 2022-07-18