Incidental Mutation 'R9497:Gpr158'
ID 717257
Institutional Source Beutler Lab
Gene Symbol Gpr158
Ensembl Gene ENSMUSG00000045967
Gene Name G protein-coupled receptor 158
Synonyms 5330427M13Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9497 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 21367542-21830547 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21827014 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 975 (V975A)
Ref Sequence ENSEMBL: ENSMUSP00000049708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055946]
AlphaFold Q8C419
Predicted Effect probably benign
Transcript: ENSMUST00000055946
AA Change: V975A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000049708
Gene: ENSMUSG00000045967
AA Change: V975A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 110 125 N/A INTRINSIC
SCOP:d1edmb_ 313 359 5e-4 SMART
Blast:EGF 318 365 2e-27 BLAST
Pfam:7tm_3 426 669 1.2e-35 PFAM
low complexity region 840 863 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik A C 1: 86,046,171 E70A possibly damaging Het
4933425L06Rik G T 13: 105,100,479 L79F probably damaging Het
Abcb5 C A 12: 118,936,115 Q272H probably damaging Het
Acoxl T C 2: 127,877,786 Y156H probably damaging Het
Alg9 T C 9: 50,800,136 F305L probably damaging Het
Apobec4 T C 1: 152,757,196 V325A probably benign Het
Aqp9 T G 9: 71,162,369 D46A probably benign Het
Atp13a4 T A 16: 29,469,312 probably null Het
BC051019 A G 7: 109,716,259 F263S probably damaging Het
Bicc1 A T 10: 70,940,998 probably null Het
Birc3 G A 9: 7,861,027 Q97* probably null Het
Capn13 G T 17: 73,326,367 T533N probably benign Het
Casp6 G A 3: 129,905,910 V13M probably benign Het
Cdh10 A T 15: 18,964,181 E143V probably damaging Het
Cobl T A 11: 12,253,501 Q1067L probably benign Het
Cr2 A G 1: 195,168,435 V241A probably damaging Het
Cyp2c23 C T 19: 44,021,646 V87M probably damaging Het
Cyp2j9 G A 4: 96,571,974 Q431* probably null Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Cyp4a12b A T 4: 115,414,571 M160L probably benign Het
Ddhd2 T A 8: 25,727,704 K715N possibly damaging Het
Ecscr T C 18: 35,718,383 Y32C probably damaging Het
Ednra A T 8: 77,720,305 L48Q probably benign Het
Eya4 C T 10: 23,111,559 probably null Het
F13a1 C A 13: 36,898,144 V529L probably benign Het
Fam151b A T 13: 92,474,113 I56K probably damaging Het
Fam19a4 T A 6: 96,843,870 I93F possibly damaging Het
Fam212a A G 9: 107,984,739 V128A probably benign Het
Fat3 A G 9: 15,992,208 I2997T probably damaging Het
Fgfr2 A T 7: 130,164,033 F817I probably damaging Het
Fras1 G T 5: 96,737,036 C2591F probably damaging Het
Fryl T C 5: 73,057,791 D2214G Het
Galntl6 A T 8: 57,837,376 D394E probably damaging Het
Ggcx C A 6: 72,429,207 N605K probably damaging Het
Gja5 A G 3: 97,051,485 N286S Het
Gm4553 A T 7: 142,165,561 C43* probably null Het
Greb1l T A 18: 10,458,600 D60E probably benign Het
Hao2 A T 3: 98,877,146 L301H probably damaging Het
Hic1 A G 11: 75,169,305 L72P possibly damaging Het
Hs3st5 A C 10: 36,833,374 N302H probably benign Het
Htr1d A G 4: 136,442,352 probably benign Het
Kdm7a T C 6: 39,151,319 D526G probably damaging Het
Kif5a T C 10: 127,243,484 S282G probably damaging Het
Klhdc7b T C 15: 89,388,260 V457A possibly damaging Het
Lcorl A G 5: 45,733,997 V421A probably benign Het
Ltc4s A G 11: 50,236,559 S150P unknown Het
Mdfic C T 6: 15,720,853 R18W unknown Het
Mdfic T G 6: 15,770,509 D171E probably benign Het
Meis2 T C 2: 115,864,243 D473G possibly damaging Het
Mettl17 A T 14: 51,891,572 Q433L unknown Het
Mettl25 T C 10: 105,841,229 R31G probably damaging Het
Mroh2b T A 15: 4,921,363 I581N probably damaging Het
Myh7 A T 14: 54,980,384 N1091K probably benign Het
Mysm1 T C 4: 94,960,398 D466G probably benign Het
Ncoa6 T C 2: 155,406,318 T1689A probably damaging Het
Ndfip2 A G 14: 105,304,811 T332A probably benign Het
Nfkbil1 G A 17: 35,220,629 P303S probably damaging Het
Nfx1 T G 4: 40,994,104 N604K probably benign Het
Npb T C 11: 120,608,647 F47L probably benign Het
Nr2c2 C T 6: 92,156,692 T259I possibly damaging Het
Obsl1 C T 1: 75,490,840 C1430Y probably damaging Het
Olfr121 T A 17: 37,752,051 Y66N probably damaging Het
Olfr1358 A G 10: 78,519,904 I99V probably benign Het
Olfr308 G A 7: 86,321,781 T57M probably damaging Het
Olfr733 C T 14: 50,298,905 V135I probably benign Het
Olfr771 C A 10: 129,160,595 V130L probably benign Het
Olfr981 A T 9: 40,023,320 H309L probably benign Het
Olfr984 G A 9: 40,100,639 P284S probably damaging Het
Pdcd6 A T 13: 74,305,576 F148I probably damaging Het
Pih1d1 A T 7: 45,154,365 Q16L unknown Het
Ppp1r10 T C 17: 35,924,894 S123P probably damaging Het
Ppp1r13b A T 12: 111,841,012 M305K probably benign Het
Prg2 A G 2: 84,981,341 K2E possibly damaging Het
Prkd1 A T 12: 50,391,324 probably null Het
Rfx7 T A 9: 72,619,141 H1204Q probably benign Het
Serpina3k A C 12: 104,343,171 Q291H probably benign Het
Tas2r107 G T 6: 131,659,586 Q167K probably benign Het
Tle1 A C 4: 72,152,898 probably benign Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Trpa1 C T 1: 14,918,802 E12K probably benign Het
Vmn2r7 T C 3: 64,707,053 T447A probably benign Het
Wdr86 T C 5: 24,715,540 Y283C probably benign Het
Zfp329 A T 7: 12,810,288 Y436* probably null Het
Other mutations in Gpr158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Gpr158 APN 2 21368683 missense probably damaging 1.00
IGL00469:Gpr158 APN 2 21746795 splice site probably benign
IGL00706:Gpr158 APN 2 21746773 missense probably damaging 1.00
IGL00780:Gpr158 APN 2 21826818 nonsense probably null
IGL00885:Gpr158 APN 2 21649021 missense probably damaging 1.00
IGL01339:Gpr158 APN 2 21369031 missense possibly damaging 0.73
IGL01368:Gpr158 APN 2 21827098 missense probably damaging 1.00
IGL02141:Gpr158 APN 2 21783290 missense probably damaging 0.99
IGL02455:Gpr158 APN 2 21368700 missense probably benign 0.00
IGL02554:Gpr158 APN 2 21826596 missense probably benign
IGL02681:Gpr158 APN 2 21815630 missense probably damaging 1.00
IGL02752:Gpr158 APN 2 21826827 missense possibly damaging 0.95
IGL02756:Gpr158 APN 2 21827079 missense possibly damaging 0.47
IGL03181:Gpr158 APN 2 21783161 missense probably benign 0.02
IGL03258:Gpr158 APN 2 21825274 missense probably damaging 1.00
IGL03386:Gpr158 APN 2 21826246 missense probably damaging 1.00
PIT4810001:Gpr158 UTSW 2 21826871 missense probably benign 0.01
R0071:Gpr158 UTSW 2 21810668 missense probably benign 0.08
R0081:Gpr158 UTSW 2 21826717 missense probably damaging 1.00
R0528:Gpr158 UTSW 2 21825208 missense probably damaging 1.00
R0560:Gpr158 UTSW 2 21825274 missense probably damaging 1.00
R0603:Gpr158 UTSW 2 21815669 missense possibly damaging 0.67
R1560:Gpr158 UTSW 2 21826314 missense probably damaging 1.00
R1561:Gpr158 UTSW 2 21815694 splice site probably null
R1609:Gpr158 UTSW 2 21783293 missense possibly damaging 0.61
R1741:Gpr158 UTSW 2 21827548 missense probably benign 0.00
R1827:Gpr158 UTSW 2 21827318 missense probably benign
R1854:Gpr158 UTSW 2 21369124 missense probably damaging 1.00
R1871:Gpr158 UTSW 2 21815615 missense probably damaging 1.00
R2151:Gpr158 UTSW 2 21827514 missense possibly damaging 0.82
R2273:Gpr158 UTSW 2 21826863 missense probably benign
R2275:Gpr158 UTSW 2 21826863 missense probably benign
R3004:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R3151:Gpr158 UTSW 2 21576960 missense possibly damaging 0.68
R3943:Gpr158 UTSW 2 21368559 missense possibly damaging 0.65
R4238:Gpr158 UTSW 2 21368551 missense probably damaging 1.00
R4379:Gpr158 UTSW 2 21825214 missense probably damaging 1.00
R4381:Gpr158 UTSW 2 21827592 missense probably damaging 1.00
R4464:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4467:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4496:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4506:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4530:Gpr158 UTSW 2 21369000 missense probably benign 0.03
R4646:Gpr158 UTSW 2 21827053 missense probably benign
R4798:Gpr158 UTSW 2 21783182 missense probably damaging 1.00
R4882:Gpr158 UTSW 2 21825248 missense probably damaging 0.98
R4943:Gpr158 UTSW 2 21827157 missense probably damaging 1.00
R5334:Gpr158 UTSW 2 21827505 missense probably benign 0.01
R5560:Gpr158 UTSW 2 21826290 missense possibly damaging 0.67
R5600:Gpr158 UTSW 2 21827235 missense probably benign
R5637:Gpr158 UTSW 2 21783272 missense probably benign 0.00
R5701:Gpr158 UTSW 2 21746709 missense probably damaging 1.00
R5744:Gpr158 UTSW 2 21368520 missense probably damaging 1.00
R5911:Gpr158 UTSW 2 21369121 missense possibly damaging 0.95
R5991:Gpr158 UTSW 2 21368508 missense probably damaging 0.99
R6200:Gpr158 UTSW 2 21399416 missense probably damaging 0.97
R6306:Gpr158 UTSW 2 21815611 missense possibly damaging 0.84
R6324:Gpr158 UTSW 2 21810554 missense probably damaging 1.00
R6384:Gpr158 UTSW 2 21826288 missense probably damaging 1.00
R6698:Gpr158 UTSW 2 21827110 missense probably damaging 1.00
R6997:Gpr158 UTSW 2 21648991 missense possibly damaging 0.46
R7086:Gpr158 UTSW 2 21826575 missense probably benign 0.01
R7175:Gpr158 UTSW 2 21368302 missense probably benign 0.13
R7197:Gpr158 UTSW 2 21810601 missense probably damaging 0.99
R7293:Gpr158 UTSW 2 21576939 missense possibly damaging 0.47
R7427:Gpr158 UTSW 2 21827318 missense probably benign
R7515:Gpr158 UTSW 2 21368281 missense probably damaging 1.00
R7730:Gpr158 UTSW 2 21826347 missense probably damaging 1.00
R8122:Gpr158 UTSW 2 21826863 missense probably benign
R8311:Gpr158 UTSW 2 21368890 missense probably benign 0.00
R8754:Gpr158 UTSW 2 21576882 missense probably benign 0.00
R8782:Gpr158 UTSW 2 21399338 missense probably damaging 1.00
R8792:Gpr158 UTSW 2 21553326 missense probably damaging 1.00
R8842:Gpr158 UTSW 2 21576940 missense possibly damaging 0.88
R9009:Gpr158 UTSW 2 21576949 missense probably damaging 1.00
R9102:Gpr158 UTSW 2 21825267 missense probably damaging 1.00
R9150:Gpr158 UTSW 2 21826440 missense probably benign 0.17
R9254:Gpr158 UTSW 2 21368231 start gained probably benign
R9317:Gpr158 UTSW 2 21827226 missense probably benign
R9379:Gpr158 UTSW 2 21368231 start gained probably benign
R9428:Gpr158 UTSW 2 21783161 missense probably benign
R9667:Gpr158 UTSW 2 21825243 missense probably damaging 0.99
R9681:Gpr158 UTSW 2 21826504 missense probably damaging 0.99
X0062:Gpr158 UTSW 2 21826369 missense probably damaging 1.00
Z1176:Gpr158 UTSW 2 21810690 critical splice donor site probably null
Z1177:Gpr158 UTSW 2 21827272 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- AGTGTCATTGCAAGTGCCAAG -3'
(R):5'- ACGAAGCAGGGTTTTGTTCCAC -3'

Sequencing Primer
(F):5'- AGAAGACACTTGGCCTGGCTG -3'
(R):5'- CACTTCAGAAGCTGCGATTG -3'
Posted On 2022-07-18