Incidental Mutation 'R9497:Atp13a4'
ID 717328
Institutional Source Beutler Lab
Gene Symbol Atp13a4
Ensembl Gene ENSMUSG00000038094
Gene Name ATPase type 13A4
Synonyms 9330174J19Rik, 4631413J11Rik
Accession Numbers

Genbank: NM_001164612, NM_172613, NM_001164613

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9497 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 29395853-29544864 bp(-) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to A at 29469312 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000060987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039090] [ENSMUST00000057018] [ENSMUST00000182013] [ENSMUST00000182627]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039090
SMART Domains Protein: ENSMUSP00000048753
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 8.4e-31 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 1.7e-36 PFAM
Pfam:Hydrolase 481 769 3.9e-11 PFAM
Pfam:HAD 484 787 4.1e-14 PFAM
Pfam:Hydrolase_like2 574 637 1.2e-9 PFAM
transmembrane domain 824 846 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000057018
SMART Domains Protein: ENSMUSP00000060987
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 9.6e-34 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 228 476 1.6e-34 PFAM
Pfam:Hydrolase 481 767 1.1e-10 PFAM
Pfam:HAD 484 858 3.3e-23 PFAM
Pfam:Cation_ATPase 573 637 4.9e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182013
SMART Domains Protein: ENSMUSP00000138583
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 84 4.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182627
SMART Domains Protein: ENSMUSP00000138479
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 2.1e-29 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 3.9e-35 PFAM
Pfam:Hydrolase 481 861 4.2e-16 PFAM
Pfam:HAD 484 858 1.9e-23 PFAM
Pfam:Hydrolase_like2 574 637 2.2e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik A C 1: 86,046,171 E70A possibly damaging Het
4933425L06Rik G T 13: 105,100,479 L79F probably damaging Het
Abcb5 C A 12: 118,936,115 Q272H probably damaging Het
Acoxl T C 2: 127,877,786 Y156H probably damaging Het
Alg9 T C 9: 50,800,136 F305L probably damaging Het
Apobec4 T C 1: 152,757,196 V325A probably benign Het
Aqp9 T G 9: 71,162,369 D46A probably benign Het
BC051019 A G 7: 109,716,259 F263S probably damaging Het
Bicc1 A T 10: 70,940,998 probably null Het
Birc3 G A 9: 7,861,027 Q97* probably null Het
Capn13 G T 17: 73,326,367 T533N probably benign Het
Casp6 G A 3: 129,905,910 V13M probably benign Het
Cdh10 A T 15: 18,964,181 E143V probably damaging Het
Cobl T A 11: 12,253,501 Q1067L probably benign Het
Cr2 A G 1: 195,168,435 V241A probably damaging Het
Cyp2c23 C T 19: 44,021,646 V87M probably damaging Het
Cyp2j9 G A 4: 96,571,974 Q431* probably null Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Cyp4a12b A T 4: 115,414,571 M160L probably benign Het
Ddhd2 T A 8: 25,727,704 K715N possibly damaging Het
Ecscr T C 18: 35,718,383 Y32C probably damaging Het
Ednra A T 8: 77,720,305 L48Q probably benign Het
Eya4 C T 10: 23,111,559 probably null Het
F13a1 C A 13: 36,898,144 V529L probably benign Het
Fam151b A T 13: 92,474,113 I56K probably damaging Het
Fam19a4 T A 6: 96,843,870 I93F possibly damaging Het
Fam212a A G 9: 107,984,739 V128A probably benign Het
Fat3 A G 9: 15,992,208 I2997T probably damaging Het
Fgfr2 A T 7: 130,164,033 F817I probably damaging Het
Fras1 G T 5: 96,737,036 C2591F probably damaging Het
Fryl T C 5: 73,057,791 D2214G Het
Galntl6 A T 8: 57,837,376 D394E probably damaging Het
Ggcx C A 6: 72,429,207 N605K probably damaging Het
Gja5 A G 3: 97,051,485 N286S Het
Gm4553 A T 7: 142,165,561 C43* probably null Het
Gpr158 T C 2: 21,827,014 V975A probably benign Het
Greb1l T A 18: 10,458,600 D60E probably benign Het
Hao2 A T 3: 98,877,146 L301H probably damaging Het
Hic1 A G 11: 75,169,305 L72P possibly damaging Het
Hs3st5 A C 10: 36,833,374 N302H probably benign Het
Htr1d A G 4: 136,442,352 probably benign Het
Kdm7a T C 6: 39,151,319 D526G probably damaging Het
Kif5a T C 10: 127,243,484 S282G probably damaging Het
Klhdc7b T C 15: 89,388,260 V457A possibly damaging Het
Lcorl A G 5: 45,733,997 V421A probably benign Het
Ltc4s A G 11: 50,236,559 S150P unknown Het
Mdfic C T 6: 15,720,853 R18W unknown Het
Mdfic T G 6: 15,770,509 D171E probably benign Het
Meis2 T C 2: 115,864,243 D473G possibly damaging Het
Mettl17 A T 14: 51,891,572 Q433L unknown Het
Mettl25 T C 10: 105,841,229 R31G probably damaging Het
Mroh2b T A 15: 4,921,363 I581N probably damaging Het
Myh7 A T 14: 54,980,384 N1091K probably benign Het
Mysm1 T C 4: 94,960,398 D466G probably benign Het
Ncoa6 T C 2: 155,406,318 T1689A probably damaging Het
Ndfip2 A G 14: 105,304,811 T332A probably benign Het
Nfkbil1 G A 17: 35,220,629 P303S probably damaging Het
Nfx1 T G 4: 40,994,104 N604K probably benign Het
Npb T C 11: 120,608,647 F47L probably benign Het
Nr2c2 C T 6: 92,156,692 T259I possibly damaging Het
Obsl1 C T 1: 75,490,840 C1430Y probably damaging Het
Olfr121 T A 17: 37,752,051 Y66N probably damaging Het
Olfr1358 A G 10: 78,519,904 I99V probably benign Het
Olfr308 G A 7: 86,321,781 T57M probably damaging Het
Olfr733 C T 14: 50,298,905 V135I probably benign Het
Olfr771 C A 10: 129,160,595 V130L probably benign Het
Olfr981 A T 9: 40,023,320 H309L probably benign Het
Olfr984 G A 9: 40,100,639 P284S probably damaging Het
Pdcd6 A T 13: 74,305,576 F148I probably damaging Het
Pih1d1 A T 7: 45,154,365 Q16L unknown Het
Ppp1r10 T C 17: 35,924,894 S123P probably damaging Het
Ppp1r13b A T 12: 111,841,012 M305K probably benign Het
Prg2 A G 2: 84,981,341 K2E possibly damaging Het
Prkd1 A T 12: 50,391,324 probably null Het
Rfx7 T A 9: 72,619,141 H1204Q probably benign Het
Serpina3k A C 12: 104,343,171 Q291H probably benign Het
Tas2r107 G T 6: 131,659,586 Q167K probably benign Het
Tle1 A C 4: 72,152,898 probably benign Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Trpa1 C T 1: 14,918,802 E12K probably benign Het
Vmn2r7 T C 3: 64,707,053 T447A probably benign Het
Wdr86 T C 5: 24,715,540 Y283C probably benign Het
Zfp329 A T 7: 12,810,288 Y436* probably null Het
Other mutations in Atp13a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Atp13a4 APN 16 29403778 splice site probably benign
IGL01577:Atp13a4 APN 16 29441284 missense possibly damaging 0.77
IGL01834:Atp13a4 APN 16 29415777 splice site probably benign
IGL02165:Atp13a4 APN 16 29434010 missense probably damaging 1.00
IGL02194:Atp13a4 APN 16 29456629 missense probably damaging 1.00
IGL02322:Atp13a4 APN 16 29440102 missense probably benign 0.00
IGL02553:Atp13a4 APN 16 29422703 missense probably benign 0.03
IGL02821:Atp13a4 APN 16 29441307 missense probably benign 0.01
IGL03349:Atp13a4 APN 16 29456671 missense probably benign 0.01
G5030:Atp13a4 UTSW 16 29455488 missense probably damaging 1.00
R0091:Atp13a4 UTSW 16 29455395 missense probably damaging 1.00
R0100:Atp13a4 UTSW 16 29421724 missense probably damaging 1.00
R0278:Atp13a4 UTSW 16 29454834 missense probably damaging 1.00
R1263:Atp13a4 UTSW 16 29471953 missense possibly damaging 0.60
R1378:Atp13a4 UTSW 16 29420428 missense probably damaging 1.00
R1575:Atp13a4 UTSW 16 29409710 missense probably benign 0.01
R1720:Atp13a4 UTSW 16 29408928 missense probably damaging 0.99
R1759:Atp13a4 UTSW 16 29456611 missense probably damaging 0.99
R1967:Atp13a4 UTSW 16 29479854 missense probably damaging 0.99
R2030:Atp13a4 UTSW 16 29422684 missense probably damaging 1.00
R2113:Atp13a4 UTSW 16 29441284 missense possibly damaging 0.77
R3409:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R3410:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R4032:Atp13a4 UTSW 16 29418571 missense probably damaging 1.00
R4163:Atp13a4 UTSW 16 29541250 missense possibly damaging 0.87
R4652:Atp13a4 UTSW 16 29452603 missense probably damaging 1.00
R4772:Atp13a4 UTSW 16 29420835 intron probably benign
R4795:Atp13a4 UTSW 16 29490008 critical splice donor site probably null
R4898:Atp13a4 UTSW 16 29408961 nonsense probably null
R4996:Atp13a4 UTSW 16 29472004 missense probably damaging 1.00
R5112:Atp13a4 UTSW 16 29409868 missense possibly damaging 0.87
R5259:Atp13a4 UTSW 16 29456610 missense probably damaging 1.00
R5395:Atp13a4 UTSW 16 29420888 nonsense probably null
R5395:Atp13a4 UTSW 16 29456604 missense possibly damaging 0.94
R5640:Atp13a4 UTSW 16 29415831 missense probably damaging 0.98
R5809:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.56
R5856:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.94
R5912:Atp13a4 UTSW 16 29456571 missense probably benign 0.33
R6282:Atp13a4 UTSW 16 29434004 missense probably benign 0.00
R6404:Atp13a4 UTSW 16 29471901 nonsense probably null
R6497:Atp13a4 UTSW 16 29479901 missense probably damaging 1.00
R6577:Atp13a4 UTSW 16 29479841 missense probably benign 0.03
R6806:Atp13a4 UTSW 16 29469280 missense probably damaging 1.00
R7229:Atp13a4 UTSW 16 29420905 missense probably benign 0.05
R7438:Atp13a4 UTSW 16 29441196 missense
R7493:Atp13a4 UTSW 16 29471956 missense
R7712:Atp13a4 UTSW 16 29459487 missense
R7739:Atp13a4 UTSW 16 29456601 missense
R7897:Atp13a4 UTSW 16 29396466 missense
R7950:Atp13a4 UTSW 16 29449917 missense
R8217:Atp13a4 UTSW 16 29403801 missense
R8227:Atp13a4 UTSW 16 29403845 missense
R8273:Atp13a4 UTSW 16 29471902 missense
R8488:Atp13a4 UTSW 16 29417836 missense possibly damaging 0.63
R8508:Atp13a4 UTSW 16 29454769 nonsense probably null
R8773:Atp13a4 UTSW 16 29441580 missense
R8921:Atp13a4 UTSW 16 29454774 missense
R8940:Atp13a4 UTSW 16 29454690 critical splice donor site probably null
R9056:Atp13a4 UTSW 16 29471888 critical splice donor site probably null
R9272:Atp13a4 UTSW 16 29449979 missense
R9292:Atp13a4 UTSW 16 29422682 missense
R9415:Atp13a4 UTSW 16 29409003 missense
R9453:Atp13a4 UTSW 16 29420841 missense unknown
R9541:Atp13a4 UTSW 16 29422726 missense
R9614:Atp13a4 UTSW 16 29441580 missense
R9622:Atp13a4 UTSW 16 29420459 missense
R9727:Atp13a4 UTSW 16 29409771 missense not run
Z1176:Atp13a4 UTSW 16 29422587 missense probably null
Predicted Primers PCR Primer
(F):5'- CACATGCAGATGAGTTATTAGGAAC -3'
(R):5'- CAGAACAAGTTAGAAGGTCATTCAC -3'

Sequencing Primer
(F):5'- GCAGATGAGTTATTAGGAACAATCAG -3'
(R):5'- TACTGGGACGACCACTCATG -3'
Posted On 2022-07-18