Incidental Mutation 'R9497:Greb1l'
ID 717333
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Name growth regulation by estrogen in breast cancer-like
Synonyms AK220484, mKIAA4095
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9497 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 10325177-10562934 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 10458600 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 60 (D60E)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532]
AlphaFold B9EJV3
Predicted Effect probably benign
Transcript: ENSMUST00000048977
AA Change: D60E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: D60E

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172532
AA Change: D60E

PolyPhen 2 Score 0.579 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: D60E

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik A C 1: 86,046,171 E70A possibly damaging Het
4933425L06Rik G T 13: 105,100,479 L79F probably damaging Het
Abcb5 C A 12: 118,936,115 Q272H probably damaging Het
Acoxl T C 2: 127,877,786 Y156H probably damaging Het
Alg9 T C 9: 50,800,136 F305L probably damaging Het
Apobec4 T C 1: 152,757,196 V325A probably benign Het
Aqp9 T G 9: 71,162,369 D46A probably benign Het
Atp13a4 T A 16: 29,469,312 probably null Het
BC051019 A G 7: 109,716,259 F263S probably damaging Het
Bicc1 A T 10: 70,940,998 probably null Het
Birc3 G A 9: 7,861,027 Q97* probably null Het
Capn13 G T 17: 73,326,367 T533N probably benign Het
Casp6 G A 3: 129,905,910 V13M probably benign Het
Cdh10 A T 15: 18,964,181 E143V probably damaging Het
Cobl T A 11: 12,253,501 Q1067L probably benign Het
Cr2 A G 1: 195,168,435 V241A probably damaging Het
Cyp2c23 C T 19: 44,021,646 V87M probably damaging Het
Cyp2j9 G A 4: 96,571,974 Q431* probably null Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Cyp4a12b A T 4: 115,414,571 M160L probably benign Het
Ddhd2 T A 8: 25,727,704 K715N possibly damaging Het
Ecscr T C 18: 35,718,383 Y32C probably damaging Het
Ednra A T 8: 77,720,305 L48Q probably benign Het
Eya4 C T 10: 23,111,559 probably null Het
F13a1 C A 13: 36,898,144 V529L probably benign Het
Fam151b A T 13: 92,474,113 I56K probably damaging Het
Fam19a4 T A 6: 96,843,870 I93F possibly damaging Het
Fam212a A G 9: 107,984,739 V128A probably benign Het
Fat3 A G 9: 15,992,208 I2997T probably damaging Het
Fgfr2 A T 7: 130,164,033 F817I probably damaging Het
Fras1 G T 5: 96,737,036 C2591F probably damaging Het
Fryl T C 5: 73,057,791 D2214G Het
Galntl6 A T 8: 57,837,376 D394E probably damaging Het
Ggcx C A 6: 72,429,207 N605K probably damaging Het
Gja5 A G 3: 97,051,485 N286S Het
Gm4553 A T 7: 142,165,561 C43* probably null Het
Gpr158 T C 2: 21,827,014 V975A probably benign Het
Hao2 A T 3: 98,877,146 L301H probably damaging Het
Hic1 A G 11: 75,169,305 L72P possibly damaging Het
Hs3st5 A C 10: 36,833,374 N302H probably benign Het
Htr1d A G 4: 136,442,352 probably benign Het
Kdm7a T C 6: 39,151,319 D526G probably damaging Het
Kif5a T C 10: 127,243,484 S282G probably damaging Het
Klhdc7b T C 15: 89,388,260 V457A possibly damaging Het
Lcorl A G 5: 45,733,997 V421A probably benign Het
Ltc4s A G 11: 50,236,559 S150P unknown Het
Mdfic C T 6: 15,720,853 R18W unknown Het
Mdfic T G 6: 15,770,509 D171E probably benign Het
Meis2 T C 2: 115,864,243 D473G possibly damaging Het
Mettl17 A T 14: 51,891,572 Q433L unknown Het
Mettl25 T C 10: 105,841,229 R31G probably damaging Het
Mroh2b T A 15: 4,921,363 I581N probably damaging Het
Myh7 A T 14: 54,980,384 N1091K probably benign Het
Mysm1 T C 4: 94,960,398 D466G probably benign Het
Ncoa6 T C 2: 155,406,318 T1689A probably damaging Het
Ndfip2 A G 14: 105,304,811 T332A probably benign Het
Nfkbil1 G A 17: 35,220,629 P303S probably damaging Het
Nfx1 T G 4: 40,994,104 N604K probably benign Het
Npb T C 11: 120,608,647 F47L probably benign Het
Nr2c2 C T 6: 92,156,692 T259I possibly damaging Het
Obsl1 C T 1: 75,490,840 C1430Y probably damaging Het
Olfr121 T A 17: 37,752,051 Y66N probably damaging Het
Olfr1358 A G 10: 78,519,904 I99V probably benign Het
Olfr308 G A 7: 86,321,781 T57M probably damaging Het
Olfr733 C T 14: 50,298,905 V135I probably benign Het
Olfr771 C A 10: 129,160,595 V130L probably benign Het
Olfr981 A T 9: 40,023,320 H309L probably benign Het
Olfr984 G A 9: 40,100,639 P284S probably damaging Het
Pdcd6 A T 13: 74,305,576 F148I probably damaging Het
Pih1d1 A T 7: 45,154,365 Q16L unknown Het
Ppp1r10 T C 17: 35,924,894 S123P probably damaging Het
Ppp1r13b A T 12: 111,841,012 M305K probably benign Het
Prg2 A G 2: 84,981,341 K2E possibly damaging Het
Prkd1 A T 12: 50,391,324 probably null Het
Rfx7 T A 9: 72,619,141 H1204Q probably benign Het
Serpina3k A C 12: 104,343,171 Q291H probably benign Het
Tas2r107 G T 6: 131,659,586 Q167K probably benign Het
Tle1 A C 4: 72,152,898 probably benign Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Trpa1 C T 1: 14,918,802 E12K probably benign Het
Vmn2r7 T C 3: 64,707,053 T447A probably benign Het
Wdr86 T C 5: 24,715,540 Y283C probably benign Het
Zfp329 A T 7: 12,810,288 Y436* probably null Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
PIT4453001:Greb1l UTSW 18 10533032 missense probably benign 0.08
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0226:Greb1l UTSW 18 10522076 intron probably benign
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10529703 missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R1967:Greb1l UTSW 18 10501049 missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2255:Greb1l UTSW 18 10554857 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10522150 missense probably damaging 0.99
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4618:Greb1l UTSW 18 10498965 missense probably benign 0.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4707:Greb1l UTSW 18 10532922 missense probably benign 0.02
R4780:Greb1l UTSW 18 10541792 missense probably benign 0.00
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10547306 missense probably damaging 0.99
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5393:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5402:Greb1l UTSW 18 10537169 missense probably benign 0.26
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7179:Greb1l UTSW 18 10544576 missense probably benign 0.00
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7275:Greb1l UTSW 18 10544561 missense probably benign 0.12
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7455:Greb1l UTSW 18 10554915 missense probably damaging 1.00
R7832:Greb1l UTSW 18 10542056 missense probably benign 0.38
R7934:Greb1l UTSW 18 10474371 nonsense probably null
R8137:Greb1l UTSW 18 10474357 missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10533060 missense probably benign 0.13
R8208:Greb1l UTSW 18 10510703 missense probably damaging 1.00
R8227:Greb1l UTSW 18 10515371 missense probably damaging 1.00
R8312:Greb1l UTSW 18 10511587 intron probably benign
R8331:Greb1l UTSW 18 10458706 missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10529687 missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10529613 missense probably benign 0.00
R8695:Greb1l UTSW 18 10544450 missense probably benign 0.01
R8795:Greb1l UTSW 18 10553739 missense probably damaging 0.98
R8836:Greb1l UTSW 18 10509257 missense probably benign 0.30
R8862:Greb1l UTSW 18 10555042 missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10529684 missense probably benign 0.18
R8874:Greb1l UTSW 18 10544896 missense probably benign 0.01
R8886:Greb1l UTSW 18 10553843 missense probably benign 0.21
R8921:Greb1l UTSW 18 10541825 missense probably benign 0.01
R8997:Greb1l UTSW 18 10510747 missense probably damaging 1.00
R9015:Greb1l UTSW 18 10541675 missense probably benign 0.00
R9018:Greb1l UTSW 18 10542004 missense possibly damaging 0.76
R9074:Greb1l UTSW 18 10532797 missense probably damaging 1.00
R9074:Greb1l UTSW 18 10558795 missense probably damaging 1.00
R9117:Greb1l UTSW 18 10542422 missense probably benign 0.31
R9189:Greb1l UTSW 18 10499983 missense probably benign
R9332:Greb1l UTSW 18 10532796 missense possibly damaging 0.92
R9367:Greb1l UTSW 18 10522130 missense probably benign 0.00
R9796:Greb1l UTSW 18 10538233 missense possibly damaging 0.69
Z1176:Greb1l UTSW 18 10515305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCACTGCAGGTAAGTTTC -3'
(R):5'- TGTCGTGCAAGATCCTTCTGG -3'

Sequencing Primer
(F):5'- GCAGGTAAGTTTCTCAATTACAGGCC -3'
(R):5'- TGCAAGATCCTTCTGGGGCAG -3'
Posted On 2022-07-18