Mutagenetix > Incidental Mutation

Incidental Mutation 'R9498:Gria4'

717372

Institutional Source

Beutler Lab

Gene Symbol

Gria4

Ensembl Gene

ENSMUSG00000025892

Gene Name

glutamate receptor, ionotropic, AMPA4 (alpha 4)

Synonyms

Gluralpha4, spkw1, Glur4, Glur-4

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.738) question?

Stock #

R9498 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

4417896-4796234 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 4503560 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000066980 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000163309] [ENSMUST00000212533]

AlphaFold

Q9Z2W8

Predicted Effect

probably benign
Transcript: ENSMUST00000027020

SMART Domains

Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3e-61	PFAM
PBPe	416	791	8.23e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000063508

SMART Domains

Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	2.5e-71	PFAM
PBPe	416	791	2.06e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163309

SMART Domains

Protein: ENSMUSP00000129316
Gene: ENSMUSG00000025892

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3.2e-62	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212533

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2200002D01Rik	CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	7: 29,247,623		probably benign	Het
Aadacl3	A	G	4: 144,456,419	Y160H	probably damaging	Het
Abca17	T	C	17: 24,265,506	Y1594C	probably damaging	Het
Abca8a	T	C	11: 110,086,548	I128M	probably damaging	Het
Abhd12b	A	G	12: 70,163,463	I138V	probably benign	Het
Adcy8	G	A	15: 64,920,196	L304F	possibly damaging	Het
Alb	T	C	5: 90,469,503	F354L	probably damaging	Het
Ampd3	T	A	7: 110,809,846	S688R	probably damaging	Het
Areg	T	G	5: 91,146,694	L237R	probably damaging	Het
Arhgef11	A	G	3: 87,733,177	S1243G	probably benign	Het
B3glct	A	G	5: 149,750,429		probably null	Het
BC030867	T	C	11: 102,259,341	S410P	probably benign	Het
Casp7	T	A	19: 56,436,335	L162Q	probably damaging	Het
Cdh22	G	T	2: 165,112,570	T677N	probably damaging	Het
Cdh7	A	G	1: 110,048,905	N100S	probably benign	Het
Cmtm5	T	A	14: 54,936,748	S31T	probably benign	Het
Col6a3	T	A	1: 90,785,928	R2295*	probably null	Het
Cpa6	T	C	1: 10,409,321	N229S	possibly damaging	Het
Dagla	G	T	19: 10,254,854	Y489*	probably null	Het
Dnah7b	A	G	1: 46,214,404	K1823R	probably benign	Het
Dnah9	T	C	11: 65,848,373	N4180D	probably damaging	Het
Dsg3	A	C	18: 20,525,221	E296D	probably damaging	Het
Ednra	A	T	8: 77,720,305	L48Q	probably benign	Het
Esco2	T	C	14: 65,831,303	D186G	probably benign	Het
Foxj2	A	G	6: 122,842,833	D560G	probably damaging	Het
Frmd3	G	A	4: 74,119,818	M105I	probably benign	Het
Gm21671	AACT	A	5: 25,950,851		probably benign	Het
Ifi204	T	C	1: 173,755,971	E227G	possibly damaging	Het
Lgalsl	T	A	11: 20,829,439	I69F	possibly damaging	Het
Myo15b	A	G	11: 115,879,958	T1588A		Het
Myo9a	A	G	9: 59,827,183	S683G	probably damaging	Het
Ncam2	T	C	16: 81,512,999	I459T	probably benign	Het
Nedd4l	T	C	18: 65,161,652		probably null	Het
Nfic	T	C	10: 81,420,668	E54G	probably damaging	Het
Nrxn1	T	C	17: 90,589,969	T920A	probably damaging	Het
Obsl1	C	T	1: 75,490,840	C1430Y	probably damaging	Het
Olfr1048	A	G	2: 86,236,494	F107L	probably damaging	Het
Pcbp2	G	A	15: 102,498,506	G357D	probably benign	Het
Pcdhb1	A	G	18: 37,265,463	S156G	probably damaging	Het
Pcdhb15	A	T	18: 37,473,837	R41*	probably null	Het
Pde1b	A	T	15: 103,527,062	D448V	probably benign	Het
Pex7	G	A	10: 19,887,113	R227*	probably null	Het
Pkp1	T	A	1: 135,890,082	Y105F	probably benign	Het
Plbd1	T	C	6: 136,612,246	T529A	possibly damaging	Het
Plxnc1	C	G	10: 94,813,142	Q1258H	possibly damaging	Het
Prr36	T	A	8: 4,213,291	T792S	unknown	Het
Rasgrf1	A	T	9: 89,944,868	T177S	probably benign	Het
Rbm14	A	G	19: 4,803,467	S296P	probably benign	Het
Rfx8	T	C	1: 39,685,514	Y229C	probably damaging	Het
Rgs3	A	T	4: 62,657,175	S600C	probably damaging	Het
Slc29a4	T	A	5: 142,718,478	S296T	probably benign	Het
Srsf6	A	G	2: 162,932,089	E68G	probably benign	Het
Svs1	AGGCCCAGCCTGATCCTAAATTTCCTATCCCCATCAGCAAAGGTGGCCCTCAAGTGGCCCAGCC	AGGCCCAGCC	6: 48,988,018		probably benign	Het
Syt13	A	T	2: 92,951,404	N317Y	possibly damaging	Het
Tars2	A	T	3: 95,740,241	L701Q	probably damaging	Het
Tbc1d16	A	T	11: 119,157,855	V324E	probably damaging	Het
Tbc1d21	A	G	9: 58,366,641	L84P	probably damaging	Het
Trappc6b	A	G	12: 59,050,341	M65T	possibly damaging	Het
Tubb1	A	G	2: 174,457,610	N362D	probably benign	Het
Tubgcp5	C	T	7: 55,813,485	T475M	possibly damaging	Het
Ugt2b37	T	C	5: 87,254,385	K129R	probably benign	Het
Vmn2r55	A	G	7: 12,670,885	V197A	probably damaging	Het
Wfdc3	G	A	2: 164,743,077	L4F	possibly damaging	Het
Zfp141	T	A	7: 42,476,346	Q234L	probably benign	Het
Zfp850	T	C	7: 27,989,850	K311R	possibly damaging	Het

Other mutations in Gria4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00814:Gria4	APN	9	4472202	missense	probably damaging	0.98
IGL01451:Gria4	APN	9	4503652	missense	probably benign	0.04
IGL01533:Gria4	APN	9	4502395	missense	probably damaging	1.00
IGL01994:Gria4	APN	9	4537726	missense	probably damaging	1.00
IGL02078:Gria4	APN	9	4793878	missense	probably damaging	0.98
IGL02183:Gria4	APN	9	4502460	missense	probably damaging	1.00
IGL02351:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL02358:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL03118:Gria4	APN	9	4793804	splice site	probably benign
IGL03131:Gria4	APN	9	4432876	missense	probably damaging	0.96
IGL03148:Gria4	APN	9	4464295	missense	possibly damaging	0.91
IGL03264:Gria4	APN	9	4513288	missense	probably benign
PIT4812001:Gria4	UTSW	9	4427128	missense	probably damaging	1.00
R0018:Gria4	UTSW	9	4432843	missense	possibly damaging	0.71
R0295:Gria4	UTSW	9	4793840	missense	possibly damaging	0.69
R0654:Gria4	UTSW	9	4464372	missense	probably benign	0.32
R0690:Gria4	UTSW	9	4427071	missense	probably damaging	1.00
R0992:Gria4	UTSW	9	4795238	missense	probably benign
R1517:Gria4	UTSW	9	4793865	missense	probably damaging	1.00
R1673:Gria4	UTSW	9	4537637	nonsense	probably null
R1713:Gria4	UTSW	9	4424448	missense	probably benign	0.20
R1961:Gria4	UTSW	9	4519546	splice site	probably benign
R2137:Gria4	UTSW	9	4427026	intron	probably benign
R2397:Gria4	UTSW	9	4537717	missense	probably damaging	1.00
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R3014:Gria4	UTSW	9	4464294	missense	probably damaging	0.97
R3412:Gria4	UTSW	9	4513278	missense	probably benign	0.00
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3733:Gria4	UTSW	9	4513295	missense	probably benign
R3897:Gria4	UTSW	9	4513260	missense	probably damaging	1.00
R4404:Gria4	UTSW	9	4464489	splice site	probably null
R4457:Gria4	UTSW	9	4427074	missense	probably damaging	1.00
R4672:Gria4	UTSW	9	4664981	missense	possibly damaging	0.96
R4865:Gria4	UTSW	9	4464295	missense	possibly damaging	0.91
R5092:Gria4	UTSW	9	4472176	missense	probably benign	0.01
R5109:Gria4	UTSW	9	4472168	missense	probably damaging	1.00
R5202:Gria4	UTSW	9	4424330	missense	probably benign	0.10
R5828:Gria4	UTSW	9	4432832	missense	probably damaging	1.00
R5945:Gria4	UTSW	9	4456122	missense	probably damaging	1.00
R5985:Gria4	UTSW	9	4503593	missense	probably damaging	0.99
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6111:Gria4	UTSW	9	4502430	missense	probably damaging	1.00
R6190:Gria4	UTSW	9	4420199	missense	probably benign
R6280:Gria4	UTSW	9	4456072	missense	probably damaging	1.00
R6406:Gria4	UTSW	9	4427077	missense	probably damaging	1.00
R6470:Gria4	UTSW	9	4503680	missense	probably damaging	1.00
R6485:Gria4	UTSW	9	4464249	missense	probably damaging	1.00
R6612:Gria4	UTSW	9	4472206	missense	possibly damaging	0.93
R6848:Gria4	UTSW	9	4793822	missense	probably damaging	1.00
R7046:Gria4	UTSW	9	4420278	missense	probably damaging	0.97
R7210:Gria4	UTSW	9	4464135	missense	probably damaging	1.00
R7284:Gria4	UTSW	9	4472017	missense	probably damaging	1.00
R7475:Gria4	UTSW	9	4513330	missense	probably damaging	1.00
R7501:Gria4	UTSW	9	4502436	missense	probably benign	0.01
R7536:Gria4	UTSW	9	4464298	missense	probably damaging	1.00
R7604:Gria4	UTSW	9	4464315	missense	probably damaging	1.00
R7643:Gria4	UTSW	9	4793950	missense	probably benign	0.00
R7669:Gria4	UTSW	9	4462029	missense	probably damaging	1.00
R7703:Gria4	UTSW	9	4503588	missense	probably benign
R7720:Gria4	UTSW	9	4464288	missense	probably damaging	1.00
R7724:Gria4	UTSW	9	4472074	missense	probably damaging	1.00
R7909:Gria4	UTSW	9	4464450	missense	probably damaging	1.00
R8007:Gria4	UTSW	9	4503740	splice site	probably benign
R8044:Gria4	UTSW	9	4456216	missense	probably damaging	1.00
R8062:Gria4	UTSW	9	4480273	missense	possibly damaging	0.54
R8131:Gria4	UTSW	9	4502429	missense	probably benign	0.16
R8212:Gria4	UTSW	9	4480242	missense	probably benign
R8478:Gria4	UTSW	9	4793882	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424347	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424351	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4456106	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4795189	missense	possibly damaging	0.92
R8888:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R8895:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R9160:Gria4	UTSW	9	4424412	missense	probably damaging	1.00
R9743:Gria4	UTSW	9	4464457	missense	probably damaging	1.00
X0023:Gria4	UTSW	9	4427067	missense	probably damaging	1.00
X0065:Gria4	UTSW	9	4464340	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- ATTTCTGCCTGGCTGAGTCC -3'
(R):5'- CATGCTTTAACTTTGCTCAGTACAC -3'

Sequencing Primer
(F):5'- TGGAATACTGGACTCTTGATAACC -3'
(R):5'- ACACTTCTGCTCTCACTTACGATGG -3'

Posted On

2022-07-18