Incidental Mutation 'R9498:Nedd4l'
ID 717398
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Name neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms Nedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R9498 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 65020776-65350899 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 65294723 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000225261] [ENSMUST00000226058]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000080418
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163516
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect probably null
Transcript: ENSMUST00000224347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224890
Predicted Effect probably benign
Transcript: ENSMUST00000225261
Predicted Effect probably null
Transcript: ENSMUST00000226058
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
Aadacl3 A G 4: 144,182,989 (GRCm39) Y160H probably damaging Het
Abca17 T C 17: 24,484,480 (GRCm39) Y1594C probably damaging Het
Abca8a T C 11: 109,977,374 (GRCm39) I128M probably damaging Het
Abhd12b A G 12: 70,210,237 (GRCm39) I138V probably benign Het
Adcy8 G A 15: 64,792,045 (GRCm39) L304F possibly damaging Het
Alb T C 5: 90,617,362 (GRCm39) F354L probably damaging Het
Ampd3 T A 7: 110,409,053 (GRCm39) S688R probably damaging Het
Aoc1l3 AGGCCCAGCCTGATCCTAAATTTCCTATCCCCATCAGCAAAGGTGGCCCTCAAGTGGCCCAGCC AGGCCCAGCC 6: 48,964,952 (GRCm39) probably benign Het
Areg T G 5: 91,294,553 (GRCm39) L237R probably damaging Het
Arhgef11 A G 3: 87,640,484 (GRCm39) S1243G probably benign Het
B3glct A G 5: 149,673,894 (GRCm39) probably null Het
Casp7 T A 19: 56,424,767 (GRCm39) L162Q probably damaging Het
Cdh20 A G 1: 109,976,635 (GRCm39) N100S probably benign Het
Cdh22 G T 2: 164,954,490 (GRCm39) T677N probably damaging Het
Cmtm5 T A 14: 55,174,205 (GRCm39) S31T probably benign Het
Col6a3 T A 1: 90,713,650 (GRCm39) R2295* probably null Het
Cpa6 T C 1: 10,479,546 (GRCm39) N229S possibly damaging Het
Dagla G T 19: 10,232,218 (GRCm39) Y489* probably null Het
Dnah7b A G 1: 46,253,564 (GRCm39) K1823R probably benign Het
Dnah9 T C 11: 65,739,199 (GRCm39) N4180D probably damaging Het
Dsg3 A C 18: 20,658,278 (GRCm39) E296D probably damaging Het
Ednra A T 8: 78,446,934 (GRCm39) L48Q probably benign Het
Esco2 T C 14: 66,068,752 (GRCm39) D186G probably benign Het
Foxj2 A G 6: 122,819,792 (GRCm39) D560G probably damaging Het
Frmd3 G A 4: 74,038,055 (GRCm39) M105I probably benign Het
Gria4 A T 9: 4,503,560 (GRCm39) probably null Het
Hrob T C 11: 102,150,167 (GRCm39) S410P probably benign Het
Ifi204 T C 1: 173,583,537 (GRCm39) E227G possibly damaging Het
Lgalsl T A 11: 20,779,439 (GRCm39) I69F possibly damaging Het
Myo15b A G 11: 115,770,784 (GRCm39) T1588A Het
Myo9a A G 9: 59,734,466 (GRCm39) S683G probably damaging Het
Ncam2 T C 16: 81,309,887 (GRCm39) I459T probably benign Het
Nfic T C 10: 81,256,502 (GRCm39) E54G probably damaging Het
Nrxn1 T C 17: 90,897,397 (GRCm39) T920A probably damaging Het
Obsl1 C T 1: 75,467,484 (GRCm39) C1430Y probably damaging Het
Or8k17 A G 2: 86,066,838 (GRCm39) F107L probably damaging Het
Pcbp2 G A 15: 102,406,941 (GRCm39) G357D probably benign Het
Pcdhb1 A G 18: 37,398,516 (GRCm39) S156G probably damaging Het
Pcdhb15 A T 18: 37,606,890 (GRCm39) R41* probably null Het
Pde1b A T 15: 103,435,489 (GRCm39) D448V probably benign Het
Pex7 G A 10: 19,762,859 (GRCm39) R227* probably null Het
Pkp1 T A 1: 135,817,820 (GRCm39) Y105F probably benign Het
Plbd1 T C 6: 136,589,244 (GRCm39) T529A possibly damaging Het
Plxnc1 C G 10: 94,649,004 (GRCm39) Q1258H possibly damaging Het
Prr36 T A 8: 4,263,291 (GRCm39) T792S unknown Het
Rasgrf1 A T 9: 89,826,921 (GRCm39) T177S probably benign Het
Rbm14 A G 19: 4,853,495 (GRCm39) S296P probably benign Het
Rfx8 T C 1: 39,724,674 (GRCm39) Y229C probably damaging Het
Rgs3 A T 4: 62,575,412 (GRCm39) S600C probably damaging Het
Slc29a4 T A 5: 142,704,233 (GRCm39) S296T probably benign Het
Speer4a3 AACT A 5: 26,155,849 (GRCm39) probably benign Het
Srsf6 A G 2: 162,774,009 (GRCm39) E68G probably benign Het
Syt13 A T 2: 92,781,749 (GRCm39) N317Y possibly damaging Het
Tars2 A T 3: 95,647,553 (GRCm39) L701Q probably damaging Het
Tbc1d16 A T 11: 119,048,681 (GRCm39) V324E probably damaging Het
Tbc1d21 A G 9: 58,273,924 (GRCm39) L84P probably damaging Het
Trappc6b A G 12: 59,097,127 (GRCm39) M65T possibly damaging Het
Tubb1 A G 2: 174,299,403 (GRCm39) N362D probably benign Het
Tubgcp5 C T 7: 55,463,233 (GRCm39) T475M possibly damaging Het
Ugt2b37 T C 5: 87,402,244 (GRCm39) K129R probably benign Het
Vmn2r55 A G 7: 12,404,812 (GRCm39) V197A probably damaging Het
Wfdc3 G A 2: 164,584,997 (GRCm39) L4F possibly damaging Het
Zfp141 T A 7: 42,125,770 (GRCm39) Q234L probably benign Het
Zfp850 T C 7: 27,689,275 (GRCm39) K311R possibly damaging Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65,341,163 (GRCm39) missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65,305,470 (GRCm39) missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65,306,025 (GRCm39) missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65,341,116 (GRCm39) splice site probably benign
IGL02440:Nedd4l APN 18 65,296,244 (GRCm39) critical splice donor site probably null
IGL02444:Nedd4l APN 18 65,337,028 (GRCm39) splice site probably benign
IGL02700:Nedd4l APN 18 65,342,751 (GRCm39) missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65,294,723 (GRCm39) critical splice donor site probably null
IGL02999:Nedd4l APN 18 65,331,778 (GRCm39) missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65,338,741 (GRCm39) missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65,314,391 (GRCm39) splice site probably benign
R0036:Nedd4l UTSW 18 65,184,194 (GRCm39) intron probably benign
R0396:Nedd4l UTSW 18 65,294,725 (GRCm39) splice site probably benign
R0472:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65,306,092 (GRCm39) missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65,328,256 (GRCm39) splice site probably benign
R0609:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65,341,574 (GRCm39) splice site probably benign
R1077:Nedd4l UTSW 18 65,300,570 (GRCm39) splice site probably benign
R1643:Nedd4l UTSW 18 65,331,712 (GRCm39) missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65,291,010 (GRCm39) missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65,345,862 (GRCm39) missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65,300,646 (GRCm39) critical splice donor site probably null
R1986:Nedd4l UTSW 18 65,276,874 (GRCm39) missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65,345,891 (GRCm39) missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65,296,201 (GRCm39) missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65,312,049 (GRCm39) missense probably benign 0.00
R3500:Nedd4l UTSW 18 65,345,931 (GRCm39) missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65,300,606 (GRCm39) missense probably benign
R4435:Nedd4l UTSW 18 65,345,896 (GRCm39) missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65,336,951 (GRCm39) missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65,298,676 (GRCm39) missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65,305,998 (GRCm39) missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65,337,016 (GRCm39) missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65,213,131 (GRCm39) nonsense probably null
R5106:Nedd4l UTSW 18 65,326,376 (GRCm39) missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65,324,518 (GRCm39) missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65,307,315 (GRCm39) critical splice donor site probably null
R6465:Nedd4l UTSW 18 65,288,335 (GRCm39) missense probably benign 0.06
R6479:Nedd4l UTSW 18 65,342,752 (GRCm39) missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65,307,305 (GRCm39) missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65,300,622 (GRCm39) missense probably benign 0.36
R7065:Nedd4l UTSW 18 65,329,040 (GRCm39) missense probably benign 0.04
R7068:Nedd4l UTSW 18 65,338,722 (GRCm39) missense probably damaging 1.00
R7193:Nedd4l UTSW 18 65,130,441 (GRCm39) missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65,213,089 (GRCm39) missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65,319,438 (GRCm39) missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65,207,845 (GRCm39) missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65,342,769 (GRCm39) missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65,324,560 (GRCm39) missense probably damaging 0.98
R8440:Nedd4l UTSW 18 65,022,126 (GRCm39) splice site probably null
R8499:Nedd4l UTSW 18 65,342,728 (GRCm39) missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65,336,986 (GRCm39) missense probably benign 0.00
R8801:Nedd4l UTSW 18 65,288,346 (GRCm39) missense probably damaging 1.00
R8896:Nedd4l UTSW 18 65,298,688 (GRCm39) missense probably benign
R9025:Nedd4l UTSW 18 65,311,995 (GRCm39) missense probably damaging 0.98
R9040:Nedd4l UTSW 18 65,342,734 (GRCm39) missense probably damaging 0.99
R9482:Nedd4l UTSW 18 65,021,031 (GRCm39) unclassified probably benign
R9599:Nedd4l UTSW 18 65,343,400 (GRCm39) missense probably damaging 1.00
RF013:Nedd4l UTSW 18 65,342,751 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCATGGCTCTGAATACCC -3'
(R):5'- ACGAGTCACTGGGTTTGGTC -3'

Sequencing Primer
(F):5'- ATGGCTCTGAATACCCCTTCTC -3'
(R):5'- GGTCAAACGTTGGTTTCACAAGC -3'
Posted On 2022-07-18