Incidental Mutation 'R9499:Arhgef5'
ID 717419
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene Name Rho guanine nucleotide exchange factor 5
Synonyms 2210412D05Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9499 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 43242578-43266254 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43260940 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 1455 (H1455L)
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
AlphaFold E9Q7D5
Predicted Effect
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: H1455L

DomainStartEndE-ValueType
Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182924
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 T C 14: 8,028,329 (GRCm38) I20T possibly damaging Het
Apoa5 G C 9: 46,181,944 (GRCm39) R340P probably damaging Het
Arhgap21 A T 2: 20,886,397 (GRCm39) V270E probably damaging Het
Arhgef17 T C 7: 100,526,102 (GRCm39) M851V possibly damaging Het
Birc6 T A 17: 74,916,064 (GRCm39) L1660Q probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Cep120 C A 18: 53,819,033 (GRCm39) R886L possibly damaging Het
Cep290 T C 10: 100,372,729 (GRCm39) S1176P probably damaging Het
Cyp2j7 C T 4: 96,115,840 (GRCm39) R202H probably damaging Het
Cyp2t4 G A 7: 26,854,717 (GRCm39) V66M possibly damaging Het
Depdc7 C T 2: 104,553,220 (GRCm39) probably null Het
Dnaaf11 T C 15: 66,361,483 (GRCm39) E6G probably damaging Het
Erbb4 G A 1: 68,779,642 (GRCm39) Q45* probably null Het
Ercc6 C T 14: 32,284,525 (GRCm39) R763C probably damaging Het
Gm14401 C T 2: 176,778,337 (GRCm39) A141V probably benign Het
Gm14496 A G 2: 181,638,179 (GRCm39) K418E probably benign Het
Gm8159 T A 14: 15,850,264 (GRCm39) I161K probably damaging Het
Hnrnpk A G 13: 58,544,058 (GRCm39) S116P probably benign Het
Hs3st6 T C 17: 24,977,228 (GRCm39) L236P probably damaging Het
Il15 T A 8: 83,061,177 (GRCm39) H100L probably benign Het
Inpp5f A T 7: 128,295,437 (GRCm39) I744F possibly damaging Het
Kif14 C A 1: 136,455,219 (GRCm39) S1630R probably damaging Het
Madd T C 2: 91,000,434 (GRCm39) T544A probably damaging Het
Mbl2 G A 19: 30,216,664 (GRCm39) A159T probably damaging Het
Mfsd9 T C 1: 40,813,152 (GRCm39) T388A probably damaging Het
Mtor C T 4: 148,599,397 (GRCm39) R1482C probably damaging Het
Myh11 T A 16: 14,064,673 (GRCm39) E215V Het
Nmd3 T C 3: 69,647,329 (GRCm39) V277A possibly damaging Het
Nr2e1 A T 10: 42,447,487 (GRCm39) M175K probably benign Het
Nrxn1 T C 17: 90,937,450 (GRCm39) K669R probably damaging Het
Patl1 T A 19: 11,897,728 (GRCm39) M105K possibly damaging Het
Pck2 T A 14: 55,780,081 (GRCm39) I110N probably damaging Het
Pdzrn3 T C 6: 101,127,855 (GRCm39) D937G probably damaging Het
Phb1 G A 11: 95,562,257 (GRCm39) V45I probably benign Het
Pi4ka T C 16: 17,125,574 (GRCm39) E1187G Het
Piezo2 T C 18: 63,166,033 (GRCm39) E2066G possibly damaging Het
Plin1 T C 7: 79,372,544 (GRCm39) N343D probably benign Het
Polr1b C T 2: 128,957,684 (GRCm39) R580* probably null Het
Rexo5 A G 7: 119,404,480 (GRCm39) E192G probably damaging Het
Rpain T C 11: 70,865,816 (GRCm39) S194P probably damaging Het
Slco6c1 T C 1: 97,055,827 (GRCm39) S25G probably benign Het
Slitrk5 C T 14: 111,916,496 (GRCm39) T40I probably benign Het
Slu7 G A 11: 43,329,095 (GRCm39) V106I probably benign Het
Ssb T A 2: 69,696,982 (GRCm39) D107E probably benign Het
Stc2 A G 11: 31,310,332 (GRCm39) S235P probably benign Het
Sult2a8 A C 7: 14,157,487 (GRCm39) V116G probably damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,354,015 (GRCm39) probably benign Het
Tgm1 T C 14: 55,950,933 (GRCm39) probably benign Het
Tle5 T C 10: 81,399,988 (GRCm39) V62A probably damaging Het
Trf C T 9: 103,099,283 (GRCm39) V339I probably benign Het
Ucp1 T C 8: 84,024,509 (GRCm39) L278P probably damaging Het
Vmn1r24 T A 6: 57,933,150 (GRCm39) I123F possibly damaging Het
Vmn2r9 T A 5: 108,995,584 (GRCm39) N355Y probably damaging Het
Yipf4 T C 17: 74,806,024 (GRCm39) F221S probably damaging Het
Zfp1005 C A 2: 150,109,856 (GRCm39) T182K unknown Het
Zfp595 A T 13: 67,465,067 (GRCm39) S402T probably damaging Het
Zfp710 A G 7: 79,731,621 (GRCm39) E266G probably damaging Het
Zfp827 T G 8: 79,787,403 (GRCm39) W190G probably damaging Het
Zscan4c T C 7: 10,740,853 (GRCm39) V124A probably benign Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43,257,203 (GRCm39) nonsense probably null
IGL01341:Arhgef5 APN 6 43,260,925 (GRCm39) missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43,250,962 (GRCm39) missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43,251,538 (GRCm39) missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43,249,345 (GRCm39) missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43,252,064 (GRCm39) missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43,260,916 (GRCm39) missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43,249,869 (GRCm39) nonsense probably null
IGL03292:Arhgef5 APN 6 43,257,180 (GRCm39) missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43,250,934 (GRCm39) missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43,257,585 (GRCm39) missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43,242,555 (GRCm39) splice site probably null
R0206:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43,250,330 (GRCm39) missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43,260,846 (GRCm39) missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43,260,846 (GRCm39) missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43,251,568 (GRCm39) missense probably damaging 0.99
R1529:Arhgef5 UTSW 6 43,256,449 (GRCm39) missense probably damaging 0.96
R1532:Arhgef5 UTSW 6 43,250,337 (GRCm39) missense probably benign
R1663:Arhgef5 UTSW 6 43,253,899 (GRCm39) missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43,257,133 (GRCm39) missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43,252,119 (GRCm39) missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43,265,616 (GRCm39) missense probably damaging 1.00
R1880:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R2146:Arhgef5 UTSW 6 43,260,252 (GRCm39) missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43,251,354 (GRCm39) missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43,250,724 (GRCm39) missense probably benign
R4205:Arhgef5 UTSW 6 43,250,766 (GRCm39) missense possibly damaging 0.76
R4226:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4227:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4308:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4457:Arhgef5 UTSW 6 43,251,027 (GRCm39) missense probably damaging 1.00
R4469:Arhgef5 UTSW 6 43,252,033 (GRCm39) missense probably benign
R4636:Arhgef5 UTSW 6 43,251,876 (GRCm39) missense probably benign 0.11
R4791:Arhgef5 UTSW 6 43,260,117 (GRCm39) missense probably damaging 1.00
R4818:Arhgef5 UTSW 6 43,250,484 (GRCm39) missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43,249,762 (GRCm39) missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43,249,762 (GRCm39) missense probably benign 0.01
R5127:Arhgef5 UTSW 6 43,250,148 (GRCm39) missense probably damaging 0.99
R5209:Arhgef5 UTSW 6 43,250,634 (GRCm39) missense probably benign 0.01
R5245:Arhgef5 UTSW 6 43,242,614 (GRCm39) start gained probably benign
R5251:Arhgef5 UTSW 6 43,249,815 (GRCm39) missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43,249,273 (GRCm39) missense probably damaging 0.96
R5613:Arhgef5 UTSW 6 43,250,997 (GRCm39) missense probably benign 0.01
R5616:Arhgef5 UTSW 6 43,252,874 (GRCm39) missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43,252,038 (GRCm39) missense probably benign 0.15
R6024:Arhgef5 UTSW 6 43,252,068 (GRCm39) missense probably benign 0.00
R6735:Arhgef5 UTSW 6 43,251,966 (GRCm39) missense probably benign 0.01
R6825:Arhgef5 UTSW 6 43,251,895 (GRCm39) missense probably damaging 0.99
R6831:Arhgef5 UTSW 6 43,257,933 (GRCm39) missense probably damaging 1.00
R6901:Arhgef5 UTSW 6 43,250,232 (GRCm39) missense probably benign 0.00
R6932:Arhgef5 UTSW 6 43,251,351 (GRCm39) missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43,252,276 (GRCm39) missense probably benign 0.00
R7018:Arhgef5 UTSW 6 43,265,665 (GRCm39) missense probably damaging 1.00
R7180:Arhgef5 UTSW 6 43,252,142 (GRCm39) missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43,250,166 (GRCm39) nonsense probably null
R7358:Arhgef5 UTSW 6 43,256,507 (GRCm39) missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43,257,216 (GRCm39) missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43,257,605 (GRCm39) nonsense probably null
R7503:Arhgef5 UTSW 6 43,250,933 (GRCm39) missense probably benign 0.15
R7699:Arhgef5 UTSW 6 43,251,691 (GRCm39) missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43,251,691 (GRCm39) missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43,250,728 (GRCm39) missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43,252,069 (GRCm39) nonsense probably null
R7950:Arhgef5 UTSW 6 43,250,859 (GRCm39) missense possibly damaging 0.76
R8161:Arhgef5 UTSW 6 43,260,885 (GRCm39) missense probably damaging 1.00
R8178:Arhgef5 UTSW 6 43,252,119 (GRCm39) missense probably benign 0.00
R8203:Arhgef5 UTSW 6 43,257,579 (GRCm39) missense probably damaging 1.00
R8318:Arhgef5 UTSW 6 43,252,933 (GRCm39) critical splice donor site probably null
R8857:Arhgef5 UTSW 6 43,264,558 (GRCm39) missense probably damaging 1.00
R9610:Arhgef5 UTSW 6 43,257,890 (GRCm39) missense probably damaging 0.99
R9611:Arhgef5 UTSW 6 43,257,890 (GRCm39) missense probably damaging 0.99
R9623:Arhgef5 UTSW 6 43,251,736 (GRCm39) missense possibly damaging 0.86
R9685:Arhgef5 UTSW 6 43,250,527 (GRCm39) missense probably benign 0.11
RF023:Arhgef5 UTSW 6 43,256,407 (GRCm39) missense probably damaging 1.00
X0028:Arhgef5 UTSW 6 43,250,635 (GRCm39) missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43,249,342 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGTGGGTGAAGTTCCAAAAC -3'
(R):5'- AAGCAGATGTTCAGCTGTGG -3'

Sequencing Primer
(F):5'- GGGTGAAGTTCCAAAACTCTAGACTC -3'
(R):5'- GCTGTGGTGGCAACTTCACATC -3'
Posted On 2022-07-18