Incidental Mutation 'R9499:Cep120'
ID 717458
Institutional Source Beutler Lab
Gene Symbol Cep120
Ensembl Gene ENSMUSG00000048799
Gene Name centrosomal protein 120
Synonyms Ccdc100
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.779) question?
Stock # R9499 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 53681724-53744547 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 53685961 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 886 (R886L)
Ref Sequence ENSEMBL: ENSMUSP00000062433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049811]
AlphaFold Q7TSG1
Predicted Effect possibly damaging
Transcript: ENSMUST00000049811
AA Change: R886L

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062433
Gene: ENSMUSG00000048799
AA Change: R886L

DomainStartEndE-ValueType
Pfam:C2 9 114 4.8e-5 PFAM
Pfam:DUF3668 118 340 1e-96 PFAM
low complexity region 378 396 N/A INTRINSIC
Pfam:C2 520 568 1.9e-3 PFAM
low complexity region 632 642 N/A INTRINSIC
SCOP:d1eq1a_ 661 803 2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the microtubule-dependent coupling of the nucleus and the centrosome. A similar protein in mouse plays a role in both interkinetic nuclear migration, which is a characteristic pattern of nuclear movement in neural progenitors, and in neural progenitor self-renewal. Mutations in this gene are predicted to result in neurogenic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic growth arrest at E8.5 and die during organogenesis exhibiting abnormal direction of heart looping. Primary mouse embryonic fibroblasts lack cilia and either one or both centrioles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 T C 14: 8,028,329 I20T possibly damaging Het
Aes T C 10: 81,564,154 V62A probably damaging Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Arhgap21 A T 2: 20,881,586 V270E probably damaging Het
Arhgef17 T C 7: 100,876,895 M851V possibly damaging Het
Arhgef5 A T 6: 43,284,006 H1455L Het
Birc6 T A 17: 74,609,069 L1660Q probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cep290 T C 10: 100,536,867 S1176P probably damaging Het
Cyp2j7 C T 4: 96,227,603 R202H probably damaging Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Depdc7 C T 2: 104,722,875 probably null Het
Erbb4 G A 1: 68,740,483 Q45* probably null Het
Ercc6 C T 14: 32,562,568 R763C probably damaging Het
Gm14124 C A 2: 150,267,936 T182K unknown Het
Gm14401 C T 2: 177,086,544 A141V probably benign Het
Gm14496 A G 2: 181,996,386 K418E probably benign Het
Gm8159 T A 14: 4,635,265 I161K probably damaging Het
Hnrnpk A G 13: 58,396,244 S116P probably benign Het
Hs3st6 T C 17: 24,758,254 L236P probably damaging Het
Il15 T A 8: 82,334,548 H100L probably benign Het
Inpp5f A T 7: 128,693,713 I744F possibly damaging Het
Kif14 C A 1: 136,527,481 S1630R probably damaging Het
Lrrc6 T C 15: 66,489,634 E6G probably damaging Het
Madd T C 2: 91,170,089 T544A probably damaging Het
Mbl2 G A 19: 30,239,264 A159T probably damaging Het
Mfsd9 T C 1: 40,773,992 T388A probably damaging Het
Mtor C T 4: 148,514,940 R1482C probably damaging Het
Myh11 T A 16: 14,246,809 E215V Het
Nmd3 T C 3: 69,739,996 V277A possibly damaging Het
Nr2e1 A T 10: 42,571,491 M175K probably benign Het
Nrxn1 T C 17: 90,630,022 K669R probably damaging Het
Patl1 T A 19: 11,920,364 M105K possibly damaging Het
Pck2 T A 14: 55,542,624 I110N probably damaging Het
Pdzrn3 T C 6: 101,150,894 D937G probably damaging Het
Phb G A 11: 95,671,431 V45I probably benign Het
Pi4ka T C 16: 17,307,710 E1187G Het
Piezo2 T C 18: 63,032,962 E2066G possibly damaging Het
Plin1 T C 7: 79,722,796 N343D probably benign Het
Polr1b C T 2: 129,115,764 R580* probably null Het
Rexo5 A G 7: 119,805,257 E192G probably damaging Het
Rpain T C 11: 70,974,990 S194P probably damaging Het
Slco6c1 T C 1: 97,128,102 S25G probably benign Het
Slitrk5 C T 14: 111,679,064 T40I probably benign Het
Slu7 G A 11: 43,438,268 V106I probably benign Het
Ssb T A 2: 69,866,638 D107E probably benign Het
Stc2 A G 11: 31,360,332 S235P probably benign Het
Sult2a8 A C 7: 14,423,562 V116G probably damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tgm1 T C 14: 55,713,476 probably benign Het
Trf C T 9: 103,222,084 V339I probably benign Het
Ucp1 T C 8: 83,297,880 L278P probably damaging Het
Vmn1r24 T A 6: 57,956,165 I123F possibly damaging Het
Vmn2r9 T A 5: 108,847,718 N355Y probably damaging Het
Yipf4 T C 17: 74,499,029 F221S probably damaging Het
Zfp595 A T 13: 67,317,003 S402T probably damaging Het
Zfp710 A G 7: 80,081,873 E266G probably damaging Het
Zfp827 T G 8: 79,060,774 W190G probably damaging Het
Zscan4c T C 7: 11,006,926 V124A probably benign Het
Other mutations in Cep120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Cep120 APN 18 53685961 missense probably benign 0.24
IGL01774:Cep120 APN 18 53706830 missense possibly damaging 0.92
IGL01862:Cep120 APN 18 53714767 missense probably benign 0.01
IGL01906:Cep120 APN 18 53714912 missense probably benign
IGL01941:Cep120 APN 18 53723148 missense probably benign 0.00
IGL02952:Cep120 APN 18 53683228 utr 3 prime probably benign
IGL03248:Cep120 APN 18 53735772 missense probably benign 0.04
IGL03379:Cep120 APN 18 53709136 missense probably benign
R0019:Cep120 UTSW 18 53709047 splice site probably benign
R0039:Cep120 UTSW 18 53685961 missense probably benign 0.24
R0763:Cep120 UTSW 18 53721737 missense probably benign 0.00
R1015:Cep120 UTSW 18 53703121 critical splice donor site probably null
R1340:Cep120 UTSW 18 53724391 missense probably damaging 1.00
R1507:Cep120 UTSW 18 53697657 missense probably damaging 0.99
R1649:Cep120 UTSW 18 53724576 missense probably damaging 1.00
R1727:Cep120 UTSW 18 53727729 missense probably benign 0.01
R1739:Cep120 UTSW 18 53719214 critical splice donor site probably null
R1873:Cep120 UTSW 18 53738488 missense probably damaging 0.98
R1913:Cep120 UTSW 18 53723286 missense probably benign 0.26
R1968:Cep120 UTSW 18 53723241 missense probably benign 0.42
R1995:Cep120 UTSW 18 53740136 missense probably damaging 1.00
R2042:Cep120 UTSW 18 53735742 missense possibly damaging 0.50
R2074:Cep120 UTSW 18 53719312 missense possibly damaging 0.83
R2116:Cep120 UTSW 18 53740136 missense probably damaging 1.00
R2215:Cep120 UTSW 18 53727635 missense probably damaging 1.00
R2697:Cep120 UTSW 18 53740125 missense probably benign 0.00
R3813:Cep120 UTSW 18 53740212 splice site probably benign
R4012:Cep120 UTSW 18 53738582 missense probably damaging 0.99
R4368:Cep120 UTSW 18 53685885 splice site probably null
R4615:Cep120 UTSW 18 53714841 missense probably damaging 1.00
R4772:Cep120 UTSW 18 53718489 missense probably damaging 1.00
R4780:Cep120 UTSW 18 53724536 missense probably benign 0.12
R5195:Cep120 UTSW 18 53721698 missense probably damaging 1.00
R5991:Cep120 UTSW 18 53721798 missense probably benign
R6156:Cep120 UTSW 18 53703223 missense probably benign 0.00
R6188:Cep120 UTSW 18 53724457 missense probably benign 0.03
R6688:Cep120 UTSW 18 53724536 missense probably benign 0.12
R6961:Cep120 UTSW 18 53703205 nonsense probably null
R7143:Cep120 UTSW 18 53683385 missense probably benign 0.00
R7282:Cep120 UTSW 18 53740089 missense probably damaging 1.00
R7813:Cep120 UTSW 18 53738506 missense probably damaging 1.00
R7818:Cep120 UTSW 18 53723103 missense probably benign
R8677:Cep120 UTSW 18 53738561 missense possibly damaging 0.90
R8724:Cep120 UTSW 18 53723127 missense possibly damaging 0.88
R9164:Cep120 UTSW 18 53719246 missense probably benign 0.02
R9225:Cep120 UTSW 18 53706824 missense probably benign 0.00
R9300:Cep120 UTSW 18 53719297 missense probably damaging 0.99
R9312:Cep120 UTSW 18 53727641 missense probably benign 0.08
R9377:Cep120 UTSW 18 53718520 missense possibly damaging 0.66
R9390:Cep120 UTSW 18 53706912 nonsense probably null
R9551:Cep120 UTSW 18 53685961 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AAGCAACTCATTCAGTAAGACTGG -3'
(R):5'- GGTCCAGAATTGGCAGCATTTC -3'

Sequencing Primer
(F):5'- GAGAAAGACTTCGCCACCTTGG -3'
(R):5'- CCAGAATTGGCAGCATTTCATTCTG -3'
Posted On 2022-07-18