Incidental Mutation 'R9500:Slc7a11'
ID 717473
Institutional Source Beutler Lab
Gene Symbol Slc7a11
Ensembl Gene ENSMUSG00000027737
Gene Name solute carrier family 7 (cationic amino acid transporter, y+ system), member 11
Synonyms sut, System x, x, 9930009M05Rik, xCT
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9500 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 49892526-50443614 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 50427752 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 182 (T182M)
Ref Sequence ENSEMBL: ENSMUSP00000029297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029297] [ENSMUST00000194462]
AlphaFold Q9WTR6
Predicted Effect probably benign
Transcript: ENSMUST00000029297
AA Change: T182M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029297
Gene: ENSMUSG00000027737
AA Change: T182M

DomainStartEndE-ValueType
Pfam:AA_permease_2 44 469 3.3e-61 PFAM
Pfam:AA_permease 49 478 1.1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194462
AA Change: T182M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141988
Gene: ENSMUSG00000027737
AA Change: T182M

DomainStartEndE-ValueType
Pfam:AA_permease_2 44 469 1.1e-60 PFAM
Pfam:AA_permease 49 479 2e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a heteromeric, sodium-independent, anionic amino acid transport system that is highly specific for cysteine and glutamate. In this system, designated Xc(-), the anionic form of cysteine is transported in exchange for glutamate. This protein has been identified as the predominant mediator of Kaposi sarcoma-associated herpesvirus fusion and entry permissiveness into cells. Also, increased expression of this gene in primary gliomas (compared to normal brain tissue) was associated with increased glutamate secretion via the XCT channels, resulting in neuronal cell death. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutant mice show a reduction in yellow pigment resulting in dilution of agouti; only pinna hairs are affected in nonagouti mice. Mice homozygous for an ENU-induced allele exhibit decreased survival of LPS-induced macrophages and increased incidence of chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,565,666 T107I possibly damaging Het
Acyp1 T A 12: 85,279,012 Y71F unknown Het
Akap11 A T 14: 78,511,103 H1281Q Het
Amz1 T C 5: 140,752,220 Y412H probably benign Het
Anxa10 C T 8: 62,092,511 M62I probably benign Het
Arhgap25 T C 6: 87,492,202 K109E probably damaging Het
Arhgap31 T A 16: 38,640,321 E43D probably damaging Het
Atf6 T C 1: 170,747,139 M577V probably damaging Het
Auts2 C A 5: 131,476,781 A82S unknown Het
Bcl3 T C 7: 19,822,677 M1V probably null Het
Cblb T C 16: 52,139,630 probably null Het
Cc2d2b T C 19: 40,809,396 V820A unknown Het
Clint1 T G 11: 45,906,367 M425R possibly damaging Het
Clvs1 A G 4: 9,429,834 D279G probably damaging Het
Colec11 A C 12: 28,595,303 I123S probably damaging Het
Crebbp C T 16: 4,093,491 E1460K probably damaging Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Dcaf8 C G 1: 172,172,342 S22R possibly damaging Het
Dmxl1 T C 18: 49,878,204 S1143P probably damaging Het
Dnhd1 T C 7: 105,704,502 I2954T probably benign Het
Dopey2 C T 16: 93,810,283 P2275L probably benign Het
Drc3 A G 11: 60,370,508 S162G probably benign Het
Ehd2 T C 7: 15,952,152 I332V possibly damaging Het
Eml1 T A 12: 108,527,699 D584E probably damaging Het
Eogt T C 6: 97,120,031 T339A probably benign Het
Gbf1 A G 19: 46,269,950 T949A probably benign Het
Gm11568 GCTGCTGCCAGCCCTGCTGCCAGCCC GCTGCTGCCAGCCCTGCTGCCAGCCCTGCTGCCAGCCC 11: 99,858,218 probably benign Het
Gm11568 AGCCC AGCCCTGCTGCCTGCCC 11: 99,858,239 probably benign Het
Gtpbp10 A T 5: 5,556,120 C88* probably null Het
Ifit1bl2 A T 19: 34,619,108 Y369* probably null Het
Igsf6 A G 7: 121,074,474 L11P probably benign Het
Lars A T 18: 42,228,661 I627N probably damaging Het
Lmo3 G T 6: 138,416,623 Q11K Het
Mical2 A T 7: 112,336,847 probably null Het
Mmp23 A G 4: 155,652,110 V158A probably benign Het
Mmp24 T C 2: 155,812,275 I391T probably damaging Het
Mrgpra3 A T 7: 47,589,652 Y175* probably null Het
Mrpl23 G A 7: 142,536,122 V65M probably damaging Het
Mup1 A G 4: 60,500,489 L85S possibly damaging Het
Myo15b T C 11: 115,886,640 L747S probably damaging Het
Nanog G T 6: 122,713,260 W208L probably damaging Het
Nkg7 A G 7: 43,437,805 Y112C probably damaging Het
Nup155 A G 15: 8,112,316 D64G probably damaging Het
Olfr1342 A G 4: 118,689,733 S240P possibly damaging Het
Palm3 T C 8: 84,027,007 S108P probably damaging Het
Pam T C 1: 97,844,600 N579D probably benign Het
Pclo A G 5: 14,675,634 E1502G unknown Het
Pde4dip A G 3: 97,888,580 S31P unknown Het
Peg10 A T 6: 4,756,871 K482N unknown Het
Phf19 A T 2: 34,911,696 L34* probably null Het
Pla2g2c A T 4: 138,734,378 K53* probably null Het
Pla2g4f T A 2: 120,312,232 probably null Het
Polk G T 13: 96,493,841 T404K probably damaging Het
Prkdc T A 16: 15,839,215 V4058D possibly damaging Het
Prox2 T A 12: 85,088,077 I477F probably damaging Het
Ptk6 A G 2: 181,195,773 V451A probably benign Het
Ptpn3 C T 4: 57,205,914 E693K possibly damaging Het
Rag2 G A 2: 101,630,872 G509D probably damaging Het
Rapgef2 A G 3: 79,066,786 C1418R probably benign Het
Rev1 A T 1: 38,063,133 Y716* probably null Het
Rsl1d1 T A 16: 11,193,521 T440S possibly damaging Het
Samd14 T A 11: 95,023,546 Y343* probably null Het
Sema3a A T 5: 13,565,887 D426V possibly damaging Het
Slitrk5 A G 14: 111,679,294 I117V possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Stil A T 4: 115,021,519 H384L possibly damaging Het
Suclg2 C A 6: 95,569,685 R270L probably damaging Het
Taf5 A G 19: 47,077,332 D492G probably damaging Het
Tes3-ps T A 13: 49,494,339 Y230* probably null Het
Ttc41 G T 10: 86,729,862 A427S probably benign Het
Ttn T C 2: 76,723,650 D30903G probably damaging Het
Txndc16 A T 14: 45,169,341 L219Q probably null Het
Usp34 T A 11: 23,381,337 H1098Q probably damaging Het
Vmn2r52 T A 7: 10,171,354 Y186F probably damaging Het
Zbtb41 T C 1: 139,432,068 F512S probably damaging Het
Other mutations in Slc7a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Slc7a11 APN 3 50427687 missense probably benign 0.06
IGL00990:Slc7a11 APN 3 50379069 missense probably damaging 1.00
IGL01755:Slc7a11 APN 3 50424067 missense probably benign 0.39
IGL03105:Slc7a11 APN 3 50372339 missense possibly damaging 0.67
IGL03141:Slc7a11 APN 3 50381885 missense possibly damaging 0.66
R0468:Slc7a11 UTSW 3 50384051 missense probably damaging 1.00
R0735:Slc7a11 UTSW 3 50424096 missense probably benign 0.00
R1363:Slc7a11 UTSW 3 50424051 missense probably damaging 1.00
R1466:Slc7a11 UTSW 3 50381073 splice site probably null
R1466:Slc7a11 UTSW 3 50381073 splice site probably null
R1554:Slc7a11 UTSW 3 50381896 missense probably damaging 1.00
R1734:Slc7a11 UTSW 3 50372346 nonsense probably null
R2128:Slc7a11 UTSW 3 50384109 missense probably damaging 0.97
R2504:Slc7a11 UTSW 3 50377746 splice site probably null
R3116:Slc7a11 UTSW 3 50384139 missense probably benign 0.13
R3981:Slc7a11 UTSW 3 50427774 missense probably benign
R4479:Slc7a11 UTSW 3 50417963 intron probably benign
R5117:Slc7a11 UTSW 3 50379150 missense probably damaging 0.99
R5586:Slc7a11 UTSW 3 50443083 missense possibly damaging 0.95
R5621:Slc7a11 UTSW 3 50438875 missense probably damaging 1.00
R5689:Slc7a11 UTSW 3 50372331 missense probably benign 0.01
R5692:Slc7a11 UTSW 3 50372331 missense probably benign 0.01
R5965:Slc7a11 UTSW 3 50379144 missense probably benign 0.00
R6338:Slc7a11 UTSW 3 50384043 critical splice donor site probably null
R7177:Slc7a11 UTSW 3 50443231 missense probably benign 0.00
R7337:Slc7a11 UTSW 3 50442999 missense possibly damaging 0.50
R7634:Slc7a11 UTSW 3 50424037 splice site probably null
R7756:Slc7a11 UTSW 3 50372360 missense probably benign
R7758:Slc7a11 UTSW 3 50372360 missense probably benign
R7821:Slc7a11 UTSW 3 50381027 missense probably damaging 1.00
R8112:Slc7a11 UTSW 3 50417991 missense possibly damaging 0.92
R8218:Slc7a11 UTSW 3 50424052 missense probably damaging 1.00
R8255:Slc7a11 UTSW 3 50427728 missense probably damaging 0.98
R8318:Slc7a11 UTSW 3 50417986 critical splice donor site probably null
R8396:Slc7a11 UTSW 3 50384129 missense possibly damaging 0.78
R8857:Slc7a11 UTSW 3 50438856 missense probably damaging 1.00
R8967:Slc7a11 UTSW 3 50384115 missense probably benign 0.00
R9044:Slc7a11 UTSW 3 50379183 missense probably benign 0.20
R9104:Slc7a11 UTSW 3 50377633 missense probably benign 0.01
R9404:Slc7a11 UTSW 3 50381039 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GAGTTTAAGTTCCACAAGCAAAGAC -3'
(R):5'- GAGCCATCTTAATGCAGGAGAGC -3'

Sequencing Primer
(F):5'- GTTCCACAAGCAAAGACTAATTAAGG -3'
(R):5'- AGCCTGGATCTGGACAGAGC -3'
Posted On 2022-07-18