Incidental Mutation 'R9502:Chrm5'
ID 717604
Institutional Source Beutler Lab
Gene Symbol Chrm5
Ensembl Gene ENSMUSG00000074939
Gene Name cholinergic receptor, muscarinic 5
Synonyms muscarinic acetylcholine receptor 5, M5R
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R9502 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 112309516-112311114 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 112311040 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 25 (H25Q)
Ref Sequence ENSEMBL: ENSMUSP00000097185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099589]
AlphaFold Q920H4
Predicted Effect probably damaging
Transcript: ENSMUST00000099589
AA Change: H25Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097185
Gene: ENSMUSG00000074939
AA Change: H25Q

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 38 242 2.3e-8 PFAM
Pfam:7TM_GPCR_Srsx 41 253 7.5e-8 PFAM
Pfam:7tm_1 47 495 1.5e-79 PFAM
low complexity region 507 518 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The clinical implications of this receptor are unknown; however, stimulation of this receptor is known to increase cyclic AMP levels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null allele exhibit loss of acetylcholine-induced dilation of cerebral arteries, decreased pilocarpine-induced salivation, increased water-deprivation induced drinking, and attenuated morphine reinforcement and withdrawal. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(3)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik T A 1: 52,964,662 (GRCm39) H22L possibly damaging Het
Abca2 C A 2: 25,326,895 (GRCm39) Y590* probably null Het
Acot1 G T 12: 84,061,353 (GRCm39) E220* probably null Het
Acsl5 T G 19: 55,271,744 (GRCm39) I292S probably benign Het
Acvr1b C T 15: 101,092,710 (GRCm39) H118Y probably benign Het
Aggf1 A G 13: 95,507,450 (GRCm39) C112R probably benign Het
Ap2a2 T A 7: 141,178,689 (GRCm39) N105K probably benign Het
Aste1 G A 9: 105,273,880 (GRCm39) C40Y probably benign Het
Carmil1 T C 13: 24,323,357 (GRCm39) T232A probably benign Het
Ccser2 A G 14: 36,631,090 (GRCm39) F649L probably benign Het
Cdcp3 T C 7: 130,836,815 (GRCm39) V419A possibly damaging Het
Cenpf G A 1: 189,388,978 (GRCm39) T1618I probably damaging Het
Ces5a G A 8: 94,262,308 (GRCm39) Q10* probably null Het
Cfap20dc A G 14: 8,659,452 (GRCm38) F48L probably damaging Het
Cfh A T 1: 140,040,320 (GRCm39) L592Q possibly damaging Het
Chchd6 T C 6: 89,396,763 (GRCm39) H216R probably damaging Het
Clasp2 C T 9: 113,737,866 (GRCm39) T1080I probably benign Het
Clic6 G T 16: 92,295,588 (GRCm39) G83C probably damaging Het
Coro1c A T 5: 113,988,781 (GRCm39) S187R probably damaging Het
Cyp2a4 A G 7: 26,008,004 (GRCm39) D137G probably benign Het
Ddhd1 G T 14: 45,894,679 (GRCm39) Q264K possibly damaging Het
Dhdds A T 4: 133,707,497 (GRCm39) Y235N probably damaging Het
Ephb1 T C 9: 101,918,486 (GRCm39) E341G probably damaging Het
Fam53b T C 7: 132,361,740 (GRCm39) D96G probably benign Het
Fcgbpl1 A G 7: 27,836,891 (GRCm39) D270G probably benign Het
Fermt1 G T 2: 132,781,388 (GRCm39) R67S probably benign Het
Fmnl2 C A 2: 52,998,312 (GRCm39) P559H unknown Het
Foxo3 C T 10: 42,073,021 (GRCm39) V499M probably damaging Het
Frmpd2 T A 14: 33,227,404 (GRCm39) F261I probably benign Het
Garem2 T A 5: 30,321,750 (GRCm39) L703Q possibly damaging Het
Ggct T A 6: 54,962,872 (GRCm39) I180F possibly damaging Het
Gigyf2 T A 1: 87,331,446 (GRCm39) I198K unknown Het
Gucy2d T C 7: 98,107,942 (GRCm39) F700L probably benign Het
Gucy2g T A 19: 55,198,816 (GRCm39) I776F probably damaging Het
H2ac8 T C 13: 23,755,045 (GRCm39) I80V probably benign Het
Has1 T C 17: 18,063,971 (GRCm39) Y556C probably damaging Het
Hecw1 T C 13: 14,546,567 (GRCm39) I145V probably damaging Het
Helz2 T A 2: 180,878,245 (GRCm39) Y851F possibly damaging Het
Hes7 C A 11: 69,013,711 (GRCm39) P190Q probably benign Het
Hivep1 T C 13: 42,322,779 (GRCm39) C79R Het
Hnrnpr A G 4: 136,056,681 (GRCm39) D227G probably damaging Het
Hoxb9 C A 11: 96,162,544 (GRCm39) F59L probably benign Het
Hspb1 A T 5: 135,917,930 (GRCm39) H135L probably benign Het
Igkv1-122 T A 6: 67,994,348 (GRCm39) F79I probably benign Het
Igtp G C 11: 58,097,800 (GRCm39) V324L possibly damaging Het
Il18r1 G A 1: 40,528,852 (GRCm39) A299T probably benign Het
Kat14 C A 2: 144,235,527 (GRCm39) P329Q probably damaging Het
Krt33b T A 11: 99,917,315 (GRCm39) Q179L probably benign Het
Lrrk2 C T 15: 91,607,365 (GRCm39) A576V probably damaging Het
Map3k11 A G 19: 5,740,624 (GRCm39) E117G probably damaging Het
Mgme1 C T 2: 144,114,156 (GRCm39) A86V probably benign Het
Mks1 C A 11: 87,753,766 (GRCm39) A534E probably damaging Het
Mrpl28 T A 17: 26,343,594 (GRCm39) I118N probably damaging Het
Mrps22 T A 9: 98,480,219 (GRCm39) Y102F probably damaging Het
Myt1 A T 2: 181,461,991 (GRCm39) H1000L probably damaging Het
Ncoa5 A G 2: 164,854,802 (GRCm39) Y107H possibly damaging Het
Nipsnap3a A T 4: 52,994,039 (GRCm39) Y40F probably benign Het
Nlrc4 T A 17: 74,752,580 (GRCm39) Y601F probably benign Het
Obsl1 A G 1: 75,466,267 (GRCm39) L1487P probably damaging Het
Oit3 A T 10: 59,264,173 (GRCm39) N320K probably damaging Het
Or1e33 T C 11: 73,738,825 (GRCm39) N42S probably damaging Het
Or7a38 A G 10: 78,753,559 (GRCm39) N295S probably damaging Het
Otud4 T C 8: 80,400,480 (GRCm39) S1065P probably benign Het
P3h1 A C 4: 119,094,008 (GRCm39) E221A possibly damaging Het
Pgpep1 C A 8: 71,103,899 (GRCm39) A124S probably benign Het
Pigg T A 5: 108,495,782 (GRCm39) S940T Het
Proser3 G T 7: 30,245,587 (GRCm39) T139K possibly damaging Het
Prr36 C T 8: 4,264,775 (GRCm39) R297H unknown Het
Rai14 A T 15: 10,587,947 (GRCm39) F306I possibly damaging Het
Rnase13 T A 14: 52,159,825 (GRCm39) N105Y probably damaging Het
Ros1 A G 10: 52,000,174 (GRCm39) I1138T probably benign Het
Rsbn1 C A 3: 103,822,146 (GRCm39) T127K possibly damaging Het
Rsf1 G GCCGGCGGCC 7: 97,229,116 (GRCm39) probably benign Het
Rtca T C 3: 116,301,413 (GRCm39) T45A probably benign Het
Sema6b G T 17: 56,439,500 (GRCm39) D82E probably benign Het
Serpinc1 A T 1: 160,821,179 (GRCm39) K209* probably null Het
Slc4a1 C A 11: 102,247,674 (GRCm39) R403L probably damaging Het
Smtn A G 11: 3,482,780 (GRCm39) V92A possibly damaging Het
Spag9 T C 11: 93,959,792 (GRCm39) V327A probably damaging Het
Spdl1 T C 11: 34,713,283 (GRCm39) N233S possibly damaging Het
Stimate A G 14: 30,593,463 (GRCm39) N189S probably damaging Het
Ston2 T C 12: 91,707,424 (GRCm39) D62G possibly damaging Het
Sult2a5 A G 7: 13,359,243 (GRCm39) D73G probably benign Het
Ticrr A G 7: 79,343,597 (GRCm39) E1154G probably benign Het
Tmem163 A T 1: 127,480,529 (GRCm39) M111K probably damaging Het
Tmem266 T C 9: 55,344,973 (GRCm39) V535A probably damaging Het
Tmprss7 T A 16: 45,484,555 (GRCm39) D535V probably damaging Het
Tmt1a T C 15: 100,203,215 (GRCm39) V163A probably damaging Het
Tpcn1 A C 5: 120,698,390 (GRCm39) I44S probably benign Het
Trbv12-1 T A 6: 41,090,921 (GRCm39) F98I probably damaging Het
Trhde A T 10: 114,636,697 (GRCm39) V170E probably damaging Het
Trpt1 A T 19: 6,975,578 (GRCm39) T111S probably benign Het
Ttc13 T C 8: 125,410,010 (GRCm39) T401A possibly damaging Het
Ulbp1 T C 10: 7,423,260 (GRCm39) I28V probably benign Het
Vldlr A T 19: 27,218,742 (GRCm39) D531V probably damaging Het
Vmn2r85 T A 10: 130,261,387 (GRCm39) T317S probably damaging Het
Vps33a T C 5: 123,696,705 (GRCm39) K316R probably benign Het
Vwa3b A G 1: 37,099,520 (GRCm39) N245S probably damaging Het
Zfp266 A T 9: 20,413,413 (GRCm39) C82* probably null Het
Zfp746 T C 6: 48,041,397 (GRCm39) K443R probably damaging Het
Other mutations in Chrm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01532:Chrm5 APN 2 112,309,577 (GRCm39) missense probably benign
IGL01611:Chrm5 APN 2 112,310,651 (GRCm39) nonsense probably null
IGL02152:Chrm5 APN 2 112,310,913 (GRCm39) missense probably damaging 1.00
IGL03002:Chrm5 APN 2 112,310,706 (GRCm39) missense probably damaging 1.00
C9142:Chrm5 UTSW 2 112,310,556 (GRCm39) missense probably damaging 1.00
R0200:Chrm5 UTSW 2 112,311,065 (GRCm39) missense probably benign
R0432:Chrm5 UTSW 2 112,310,000 (GRCm39) missense possibly damaging 0.76
R1158:Chrm5 UTSW 2 112,310,214 (GRCm39) missense probably benign 0.00
R1611:Chrm5 UTSW 2 112,309,532 (GRCm39) missense possibly damaging 0.74
R1621:Chrm5 UTSW 2 112,310,182 (GRCm39) missense probably benign 0.00
R1693:Chrm5 UTSW 2 112,309,625 (GRCm39) missense probably damaging 1.00
R1988:Chrm5 UTSW 2 112,310,597 (GRCm39) missense probably damaging 0.99
R1989:Chrm5 UTSW 2 112,310,597 (GRCm39) missense probably damaging 0.99
R2071:Chrm5 UTSW 2 112,309,572 (GRCm39) missense probably null 0.93
R2890:Chrm5 UTSW 2 112,310,048 (GRCm39) missense probably benign 0.00
R4659:Chrm5 UTSW 2 112,310,102 (GRCm39) missense probably benign
R4785:Chrm5 UTSW 2 112,309,930 (GRCm39) missense probably benign 0.25
R5196:Chrm5 UTSW 2 112,310,729 (GRCm39) missense probably damaging 1.00
R5734:Chrm5 UTSW 2 112,310,445 (GRCm39) missense probably benign 0.28
R6343:Chrm5 UTSW 2 112,309,793 (GRCm39) missense probably damaging 1.00
R6499:Chrm5 UTSW 2 112,310,825 (GRCm39) missense probably benign
R6672:Chrm5 UTSW 2 112,310,141 (GRCm39) missense probably benign
R6905:Chrm5 UTSW 2 112,309,901 (GRCm39) missense probably benign 0.00
R7192:Chrm5 UTSW 2 112,310,672 (GRCm39) missense probably damaging 0.97
R7775:Chrm5 UTSW 2 112,310,301 (GRCm39) missense probably benign 0.07
R7778:Chrm5 UTSW 2 112,310,301 (GRCm39) missense probably benign 0.07
R8780:Chrm5 UTSW 2 112,310,453 (GRCm39) missense possibly damaging 0.64
R9287:Chrm5 UTSW 2 112,309,610 (GRCm39) missense probably damaging 1.00
R9436:Chrm5 UTSW 2 112,309,824 (GRCm39) missense possibly damaging 0.69
X0023:Chrm5 UTSW 2 112,310,826 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCATGAGGATGTAGGTCGTG -3'
(R):5'- TGAGCGGAACTGACCTGTTTG -3'

Sequencing Primer
(F):5'- CCATGAGGATGTAGGTCGTGTAGAG -3'
(R):5'- CGGAACTGACCTGTTTGTGTTTC -3'
Posted On 2022-07-18