Incidental Mutation 'R9502:Helz2'
ID 717609
Institutional Source Beutler Lab
Gene Symbol Helz2
Ensembl Gene ENSMUSG00000027580
Gene Name helicase with zinc finger 2, transcriptional coactivator
Synonyms BC006779
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9502 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 180869408-180883820 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 180878245 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 851 (Y851F)
Ref Sequence ENSEMBL: ENSMUSP00000091756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094203] [ENSMUST00000108831] [ENSMUST00000121484]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000094203
AA Change: Y851F

PolyPhen 2 Score 0.470 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091756
Gene: ENSMUSG00000027580
AA Change: Y851F

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108831
AA Change: Y851F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104459
Gene: ENSMUSG00000027580
AA Change: Y851F

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121484
AA Change: Y851F

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112917
Gene: ENSMUSG00000027580
AA Change: Y851F

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
Pfam:AAA_11 761 877 3.9e-10 PFAM
Pfam:AAA_19 780 849 1.7e-7 PFAM
Pfam:AAA_11 870 952 2e-15 PFAM
Pfam:AAA_12 958 1162 3.8e-26 PFAM
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
Pfam:AAA_11 2400 2653 4e-42 PFAM
Pfam:AAA_12 2660 2866 2e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear transcriptional co-activator for peroxisome proliferator activated receptor alpha. The encoded protein contains a zinc finger and is a helicase that appears to be part of the peroxisome proliferator activated receptor alpha interacting complex. This gene is a member of the DNA2/NAM7 helicase gene family. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slower weight gain, hyperleptinemia, increased oxygen consumption, decreased respiratory quotient, decreased liver triglyceride level and ameliorated hyperlipidemia and hepatosteatosis when fed a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik T A 1: 52,964,662 (GRCm39) H22L possibly damaging Het
Abca2 C A 2: 25,326,895 (GRCm39) Y590* probably null Het
Acot1 G T 12: 84,061,353 (GRCm39) E220* probably null Het
Acsl5 T G 19: 55,271,744 (GRCm39) I292S probably benign Het
Acvr1b C T 15: 101,092,710 (GRCm39) H118Y probably benign Het
Aggf1 A G 13: 95,507,450 (GRCm39) C112R probably benign Het
Ap2a2 T A 7: 141,178,689 (GRCm39) N105K probably benign Het
Aste1 G A 9: 105,273,880 (GRCm39) C40Y probably benign Het
Carmil1 T C 13: 24,323,357 (GRCm39) T232A probably benign Het
Ccser2 A G 14: 36,631,090 (GRCm39) F649L probably benign Het
Cdcp3 T C 7: 130,836,815 (GRCm39) V419A possibly damaging Het
Cenpf G A 1: 189,388,978 (GRCm39) T1618I probably damaging Het
Ces5a G A 8: 94,262,308 (GRCm39) Q10* probably null Het
Cfap20dc A G 14: 8,659,452 (GRCm38) F48L probably damaging Het
Cfh A T 1: 140,040,320 (GRCm39) L592Q possibly damaging Het
Chchd6 T C 6: 89,396,763 (GRCm39) H216R probably damaging Het
Chrm5 A T 2: 112,311,040 (GRCm39) H25Q probably damaging Het
Clasp2 C T 9: 113,737,866 (GRCm39) T1080I probably benign Het
Clic6 G T 16: 92,295,588 (GRCm39) G83C probably damaging Het
Coro1c A T 5: 113,988,781 (GRCm39) S187R probably damaging Het
Cyp2a4 A G 7: 26,008,004 (GRCm39) D137G probably benign Het
Ddhd1 G T 14: 45,894,679 (GRCm39) Q264K possibly damaging Het
Dhdds A T 4: 133,707,497 (GRCm39) Y235N probably damaging Het
Ephb1 T C 9: 101,918,486 (GRCm39) E341G probably damaging Het
Fam53b T C 7: 132,361,740 (GRCm39) D96G probably benign Het
Fcgbpl1 A G 7: 27,836,891 (GRCm39) D270G probably benign Het
Fermt1 G T 2: 132,781,388 (GRCm39) R67S probably benign Het
Fmnl2 C A 2: 52,998,312 (GRCm39) P559H unknown Het
Foxo3 C T 10: 42,073,021 (GRCm39) V499M probably damaging Het
Frmpd2 T A 14: 33,227,404 (GRCm39) F261I probably benign Het
Garem2 T A 5: 30,321,750 (GRCm39) L703Q possibly damaging Het
Ggct T A 6: 54,962,872 (GRCm39) I180F possibly damaging Het
Gigyf2 T A 1: 87,331,446 (GRCm39) I198K unknown Het
Gucy2d T C 7: 98,107,942 (GRCm39) F700L probably benign Het
Gucy2g T A 19: 55,198,816 (GRCm39) I776F probably damaging Het
H2ac8 T C 13: 23,755,045 (GRCm39) I80V probably benign Het
Has1 T C 17: 18,063,971 (GRCm39) Y556C probably damaging Het
Hecw1 T C 13: 14,546,567 (GRCm39) I145V probably damaging Het
Hes7 C A 11: 69,013,711 (GRCm39) P190Q probably benign Het
Hivep1 T C 13: 42,322,779 (GRCm39) C79R Het
Hnrnpr A G 4: 136,056,681 (GRCm39) D227G probably damaging Het
Hoxb9 C A 11: 96,162,544 (GRCm39) F59L probably benign Het
Hspb1 A T 5: 135,917,930 (GRCm39) H135L probably benign Het
Igkv1-122 T A 6: 67,994,348 (GRCm39) F79I probably benign Het
Igtp G C 11: 58,097,800 (GRCm39) V324L possibly damaging Het
Il18r1 G A 1: 40,528,852 (GRCm39) A299T probably benign Het
Kat14 C A 2: 144,235,527 (GRCm39) P329Q probably damaging Het
Krt33b T A 11: 99,917,315 (GRCm39) Q179L probably benign Het
Lrrk2 C T 15: 91,607,365 (GRCm39) A576V probably damaging Het
Map3k11 A G 19: 5,740,624 (GRCm39) E117G probably damaging Het
Mgme1 C T 2: 144,114,156 (GRCm39) A86V probably benign Het
Mks1 C A 11: 87,753,766 (GRCm39) A534E probably damaging Het
Mrpl28 T A 17: 26,343,594 (GRCm39) I118N probably damaging Het
Mrps22 T A 9: 98,480,219 (GRCm39) Y102F probably damaging Het
Myt1 A T 2: 181,461,991 (GRCm39) H1000L probably damaging Het
Ncoa5 A G 2: 164,854,802 (GRCm39) Y107H possibly damaging Het
Nipsnap3a A T 4: 52,994,039 (GRCm39) Y40F probably benign Het
Nlrc4 T A 17: 74,752,580 (GRCm39) Y601F probably benign Het
Obsl1 A G 1: 75,466,267 (GRCm39) L1487P probably damaging Het
Oit3 A T 10: 59,264,173 (GRCm39) N320K probably damaging Het
Or1e33 T C 11: 73,738,825 (GRCm39) N42S probably damaging Het
Or7a38 A G 10: 78,753,559 (GRCm39) N295S probably damaging Het
Otud4 T C 8: 80,400,480 (GRCm39) S1065P probably benign Het
P3h1 A C 4: 119,094,008 (GRCm39) E221A possibly damaging Het
Pgpep1 C A 8: 71,103,899 (GRCm39) A124S probably benign Het
Pigg T A 5: 108,495,782 (GRCm39) S940T Het
Proser3 G T 7: 30,245,587 (GRCm39) T139K possibly damaging Het
Prr36 C T 8: 4,264,775 (GRCm39) R297H unknown Het
Rai14 A T 15: 10,587,947 (GRCm39) F306I possibly damaging Het
Rnase13 T A 14: 52,159,825 (GRCm39) N105Y probably damaging Het
Ros1 A G 10: 52,000,174 (GRCm39) I1138T probably benign Het
Rsbn1 C A 3: 103,822,146 (GRCm39) T127K possibly damaging Het
Rsf1 G GCCGGCGGCC 7: 97,229,116 (GRCm39) probably benign Het
Rtca T C 3: 116,301,413 (GRCm39) T45A probably benign Het
Sema6b G T 17: 56,439,500 (GRCm39) D82E probably benign Het
Serpinc1 A T 1: 160,821,179 (GRCm39) K209* probably null Het
Slc4a1 C A 11: 102,247,674 (GRCm39) R403L probably damaging Het
Smtn A G 11: 3,482,780 (GRCm39) V92A possibly damaging Het
Spag9 T C 11: 93,959,792 (GRCm39) V327A probably damaging Het
Spdl1 T C 11: 34,713,283 (GRCm39) N233S possibly damaging Het
Stimate A G 14: 30,593,463 (GRCm39) N189S probably damaging Het
Ston2 T C 12: 91,707,424 (GRCm39) D62G possibly damaging Het
Sult2a5 A G 7: 13,359,243 (GRCm39) D73G probably benign Het
Ticrr A G 7: 79,343,597 (GRCm39) E1154G probably benign Het
Tmem163 A T 1: 127,480,529 (GRCm39) M111K probably damaging Het
Tmem266 T C 9: 55,344,973 (GRCm39) V535A probably damaging Het
Tmprss7 T A 16: 45,484,555 (GRCm39) D535V probably damaging Het
Tmt1a T C 15: 100,203,215 (GRCm39) V163A probably damaging Het
Tpcn1 A C 5: 120,698,390 (GRCm39) I44S probably benign Het
Trbv12-1 T A 6: 41,090,921 (GRCm39) F98I probably damaging Het
Trhde A T 10: 114,636,697 (GRCm39) V170E probably damaging Het
Trpt1 A T 19: 6,975,578 (GRCm39) T111S probably benign Het
Ttc13 T C 8: 125,410,010 (GRCm39) T401A possibly damaging Het
Ulbp1 T C 10: 7,423,260 (GRCm39) I28V probably benign Het
Vldlr A T 19: 27,218,742 (GRCm39) D531V probably damaging Het
Vmn2r85 T A 10: 130,261,387 (GRCm39) T317S probably damaging Het
Vps33a T C 5: 123,696,705 (GRCm39) K316R probably benign Het
Vwa3b A G 1: 37,099,520 (GRCm39) N245S probably damaging Het
Zfp266 A T 9: 20,413,413 (GRCm39) C82* probably null Het
Zfp746 T C 6: 48,041,397 (GRCm39) K443R probably damaging Het
Other mutations in Helz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Helz2 APN 2 180,871,495 (GRCm39) missense probably damaging 1.00
IGL00515:Helz2 APN 2 180,874,799 (GRCm39) nonsense probably null
IGL00704:Helz2 APN 2 180,876,178 (GRCm39) missense probably damaging 1.00
IGL00847:Helz2 APN 2 180,874,038 (GRCm39) missense possibly damaging 0.73
IGL01448:Helz2 APN 2 180,875,770 (GRCm39) missense probably damaging 1.00
IGL01783:Helz2 APN 2 180,874,674 (GRCm39) missense probably damaging 1.00
IGL01790:Helz2 APN 2 180,880,274 (GRCm39) missense probably benign 0.29
IGL02116:Helz2 APN 2 180,873,978 (GRCm39) missense probably damaging 1.00
IGL02226:Helz2 APN 2 180,873,483 (GRCm39) missense probably damaging 1.00
IGL02402:Helz2 APN 2 180,872,704 (GRCm39) missense probably damaging 1.00
IGL02403:Helz2 APN 2 180,872,815 (GRCm39) missense probably damaging 1.00
IGL02733:Helz2 APN 2 180,876,819 (GRCm39) missense probably benign 0.14
IGL02869:Helz2 APN 2 180,872,939 (GRCm39) intron probably benign
IGL03003:Helz2 APN 2 180,882,046 (GRCm39) missense probably damaging 1.00
IGL03060:Helz2 APN 2 180,871,015 (GRCm39) critical splice donor site probably null
IGL03310:Helz2 APN 2 180,873,597 (GRCm39) missense probably benign 0.00
Colby UTSW 2 180,874,995 (GRCm39) missense probably damaging 1.00
ANU74:Helz2 UTSW 2 180,876,627 (GRCm39) missense probably benign 0.03
R0013:Helz2 UTSW 2 180,882,752 (GRCm39) missense probably benign
R0013:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0014:Helz2 UTSW 2 180,882,304 (GRCm39) missense probably damaging 1.00
R0014:Helz2 UTSW 2 180,882,304 (GRCm39) missense probably damaging 1.00
R0016:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0018:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0019:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0019:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0055:Helz2 UTSW 2 180,870,614 (GRCm39) missense possibly damaging 0.47
R0055:Helz2 UTSW 2 180,870,614 (GRCm39) missense possibly damaging 0.47
R0071:Helz2 UTSW 2 180,878,200 (GRCm39) missense probably damaging 1.00
R0071:Helz2 UTSW 2 180,878,200 (GRCm39) missense probably damaging 1.00
R0111:Helz2 UTSW 2 180,879,595 (GRCm39) missense probably benign 0.30
R0117:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0135:Helz2 UTSW 2 180,874,062 (GRCm39) missense probably damaging 1.00
R0194:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0242:Helz2 UTSW 2 180,872,223 (GRCm39) missense probably damaging 1.00
R0242:Helz2 UTSW 2 180,872,223 (GRCm39) missense probably damaging 1.00
R0254:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0410:Helz2 UTSW 2 180,872,386 (GRCm39) missense probably damaging 1.00
R0442:Helz2 UTSW 2 180,874,002 (GRCm39) missense probably damaging 0.97
R0497:Helz2 UTSW 2 180,871,449 (GRCm39) missense probably damaging 0.97
R0517:Helz2 UTSW 2 180,869,563 (GRCm39) missense probably benign 0.00
R0541:Helz2 UTSW 2 180,876,618 (GRCm39) missense possibly damaging 0.89
R0542:Helz2 UTSW 2 180,873,882 (GRCm39) missense probably damaging 1.00
R0591:Helz2 UTSW 2 180,873,909 (GRCm39) missense probably damaging 0.96
R0692:Helz2 UTSW 2 180,882,674 (GRCm39) missense probably benign
R0826:Helz2 UTSW 2 180,882,646 (GRCm39) missense possibly damaging 0.51
R0834:Helz2 UTSW 2 180,872,570 (GRCm39) missense probably damaging 1.00
R0880:Helz2 UTSW 2 180,877,928 (GRCm39) missense probably benign
R1170:Helz2 UTSW 2 180,871,608 (GRCm39) missense probably damaging 1.00
R1186:Helz2 UTSW 2 180,872,921 (GRCm39) missense probably damaging 1.00
R1344:Helz2 UTSW 2 180,879,389 (GRCm39) missense possibly damaging 0.89
R1358:Helz2 UTSW 2 180,874,774 (GRCm39) missense probably damaging 1.00
R1436:Helz2 UTSW 2 180,877,317 (GRCm39) missense probably damaging 0.99
R1464:Helz2 UTSW 2 180,881,447 (GRCm39) missense probably damaging 1.00
R1464:Helz2 UTSW 2 180,881,447 (GRCm39) missense probably damaging 1.00
R1466:Helz2 UTSW 2 180,878,090 (GRCm39) missense probably damaging 1.00
R1466:Helz2 UTSW 2 180,878,090 (GRCm39) missense probably damaging 1.00
R1477:Helz2 UTSW 2 180,874,597 (GRCm39) missense probably benign 0.00
R1564:Helz2 UTSW 2 180,875,021 (GRCm39) missense probably benign 0.01
R1584:Helz2 UTSW 2 180,878,090 (GRCm39) missense probably damaging 1.00
R1655:Helz2 UTSW 2 180,875,940 (GRCm39) missense probably damaging 0.99
R1757:Helz2 UTSW 2 180,878,056 (GRCm39) missense probably damaging 1.00
R1779:Helz2 UTSW 2 180,880,252 (GRCm39) missense possibly damaging 0.84
R1779:Helz2 UTSW 2 180,876,780 (GRCm39) missense probably benign
R1837:Helz2 UTSW 2 180,871,082 (GRCm39) missense probably damaging 1.00
R1845:Helz2 UTSW 2 180,873,878 (GRCm39) missense probably benign 0.02
R1894:Helz2 UTSW 2 180,876,082 (GRCm39) missense probably damaging 1.00
R1913:Helz2 UTSW 2 180,875,543 (GRCm39) missense probably damaging 1.00
R2005:Helz2 UTSW 2 180,873,122 (GRCm39) missense probably benign 0.45
R2034:Helz2 UTSW 2 180,874,371 (GRCm39) missense probably damaging 1.00
R2036:Helz2 UTSW 2 180,879,272 (GRCm39) missense probably benign 0.03
R2061:Helz2 UTSW 2 180,882,337 (GRCm39) missense probably damaging 1.00
R2088:Helz2 UTSW 2 180,876,895 (GRCm39) missense probably benign 0.07
R2142:Helz2 UTSW 2 180,873,173 (GRCm39) missense probably benign
R2180:Helz2 UTSW 2 180,875,525 (GRCm39) missense probably damaging 1.00
R2192:Helz2 UTSW 2 180,870,841 (GRCm39) nonsense probably null
R2248:Helz2 UTSW 2 180,875,226 (GRCm39) missense probably benign 0.33
R2495:Helz2 UTSW 2 180,874,705 (GRCm39) missense probably damaging 0.99
R2886:Helz2 UTSW 2 180,882,535 (GRCm39) missense probably benign
R3617:Helz2 UTSW 2 180,874,854 (GRCm39) missense probably damaging 1.00
R3776:Helz2 UTSW 2 180,882,182 (GRCm39) nonsense probably null
R3803:Helz2 UTSW 2 180,881,789 (GRCm39) missense probably damaging 0.96
R4043:Helz2 UTSW 2 180,871,503 (GRCm39) missense probably benign 0.00
R4052:Helz2 UTSW 2 180,882,268 (GRCm39) missense probably damaging 1.00
R4232:Helz2 UTSW 2 180,871,695 (GRCm39) missense probably damaging 1.00
R4521:Helz2 UTSW 2 180,870,626 (GRCm39) missense probably benign
R4624:Helz2 UTSW 2 180,881,101 (GRCm39) missense probably damaging 0.99
R4720:Helz2 UTSW 2 180,880,210 (GRCm39) missense probably damaging 1.00
R4831:Helz2 UTSW 2 180,879,210 (GRCm39) missense probably damaging 1.00
R4852:Helz2 UTSW 2 180,871,913 (GRCm39) missense probably damaging 1.00
R4894:Helz2 UTSW 2 180,877,940 (GRCm39) missense probably benign 0.01
R4915:Helz2 UTSW 2 180,874,231 (GRCm39) missense possibly damaging 0.80
R4965:Helz2 UTSW 2 180,882,709 (GRCm39) missense possibly damaging 0.79
R5022:Helz2 UTSW 2 180,882,362 (GRCm39) missense probably benign
R5089:Helz2 UTSW 2 180,876,942 (GRCm39) missense probably benign 0.14
R5190:Helz2 UTSW 2 180,872,550 (GRCm39) critical splice donor site probably null
R5309:Helz2 UTSW 2 180,876,639 (GRCm39) missense probably benign 0.08
R5358:Helz2 UTSW 2 180,877,321 (GRCm39) missense probably damaging 1.00
R5379:Helz2 UTSW 2 180,876,862 (GRCm39) missense probably benign
R5559:Helz2 UTSW 2 180,871,919 (GRCm39) missense probably damaging 0.98
R5591:Helz2 UTSW 2 180,882,051 (GRCm39) missense probably damaging 0.99
R5596:Helz2 UTSW 2 180,879,082 (GRCm39) intron probably benign
R5805:Helz2 UTSW 2 180,882,301 (GRCm39) missense probably damaging 1.00
R5823:Helz2 UTSW 2 180,878,189 (GRCm39) missense possibly damaging 0.92
R5825:Helz2 UTSW 2 180,874,449 (GRCm39) missense probably benign 0.02
R5873:Helz2 UTSW 2 180,875,821 (GRCm39) missense possibly damaging 0.78
R5928:Helz2 UTSW 2 180,872,177 (GRCm39) missense possibly damaging 0.82
R5936:Helz2 UTSW 2 180,872,560 (GRCm39) missense probably damaging 1.00
R5975:Helz2 UTSW 2 180,872,843 (GRCm39) missense probably benign 0.08
R6045:Helz2 UTSW 2 180,882,106 (GRCm39) missense probably benign 0.03
R6077:Helz2 UTSW 2 180,874,831 (GRCm39) missense probably benign 0.41
R6218:Helz2 UTSW 2 180,874,087 (GRCm39) missense probably benign 0.03
R6218:Helz2 UTSW 2 180,877,738 (GRCm39) missense probably damaging 1.00
R6315:Helz2 UTSW 2 180,874,995 (GRCm39) missense probably damaging 1.00
R6346:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6371:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6372:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6373:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6385:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6464:Helz2 UTSW 2 180,876,862 (GRCm39) missense probably benign
R6581:Helz2 UTSW 2 180,871,172 (GRCm39) missense probably damaging 0.99
R6651:Helz2 UTSW 2 180,881,350 (GRCm39) nonsense probably null
R6964:Helz2 UTSW 2 180,872,221 (GRCm39) missense probably damaging 1.00
R7061:Helz2 UTSW 2 180,882,307 (GRCm39) missense probably damaging 1.00
R7153:Helz2 UTSW 2 180,873,078 (GRCm39) missense probably benign 0.00
R7372:Helz2 UTSW 2 180,880,216 (GRCm39) missense possibly damaging 0.61
R7512:Helz2 UTSW 2 180,877,393 (GRCm39) splice site probably null
R7512:Helz2 UTSW 2 180,872,647 (GRCm39) missense probably benign 0.00
R7583:Helz2 UTSW 2 180,879,365 (GRCm39) missense probably benign 0.06
R7724:Helz2 UTSW 2 180,873,789 (GRCm39) missense probably damaging 1.00
R7733:Helz2 UTSW 2 180,872,148 (GRCm39) missense possibly damaging 0.63
R7748:Helz2 UTSW 2 180,876,324 (GRCm39) missense probably damaging 1.00
R7774:Helz2 UTSW 2 180,875,784 (GRCm39) missense probably benign
R7799:Helz2 UTSW 2 180,879,782 (GRCm39) missense probably benign 0.15
R7841:Helz2 UTSW 2 180,874,695 (GRCm39) missense probably damaging 1.00
R7939:Helz2 UTSW 2 180,879,543 (GRCm39) missense probably damaging 0.99
R8026:Helz2 UTSW 2 180,881,998 (GRCm39) missense probably benign 0.34
R8030:Helz2 UTSW 2 180,879,689 (GRCm39) missense possibly damaging 0.55
R8080:Helz2 UTSW 2 180,880,055 (GRCm39) missense probably damaging 0.99
R8237:Helz2 UTSW 2 180,871,124 (GRCm39) missense possibly damaging 0.65
R8245:Helz2 UTSW 2 180,879,895 (GRCm39) missense probably damaging 1.00
R8304:Helz2 UTSW 2 180,871,950 (GRCm39) missense probably benign 0.03
R8486:Helz2 UTSW 2 180,871,124 (GRCm39) missense probably damaging 1.00
R8556:Helz2 UTSW 2 180,871,350 (GRCm39) missense probably damaging 1.00
R8878:Helz2 UTSW 2 180,874,560 (GRCm39) missense possibly damaging 0.67
R8907:Helz2 UTSW 2 180,874,920 (GRCm39) missense possibly damaging 0.47
R8911:Helz2 UTSW 2 180,880,173 (GRCm39) missense
R8953:Helz2 UTSW 2 180,874,884 (GRCm39) missense probably damaging 1.00
R8963:Helz2 UTSW 2 180,871,407 (GRCm39) missense probably damaging 1.00
R8969:Helz2 UTSW 2 180,879,581 (GRCm39) missense probably benign 0.19
R8976:Helz2 UTSW 2 180,876,486 (GRCm39) missense possibly damaging 0.46
R9015:Helz2 UTSW 2 180,870,792 (GRCm39) missense probably damaging 1.00
R9031:Helz2 UTSW 2 180,874,261 (GRCm39) missense possibly damaging 0.78
R9052:Helz2 UTSW 2 180,881,968 (GRCm39) missense possibly damaging 0.78
R9089:Helz2 UTSW 2 180,881,433 (GRCm39) missense probably damaging 1.00
R9145:Helz2 UTSW 2 180,881,848 (GRCm39) missense probably damaging 1.00
R9185:Helz2 UTSW 2 180,871,883 (GRCm39) missense probably benign
R9186:Helz2 UTSW 2 180,876,457 (GRCm39) missense possibly damaging 0.57
R9373:Helz2 UTSW 2 180,882,741 (GRCm39) missense probably benign
R9407:Helz2 UTSW 2 180,881,975 (GRCm39) missense probably benign 0.01
R9465:Helz2 UTSW 2 180,874,710 (GRCm39) missense probably benign 0.01
R9538:Helz2 UTSW 2 180,882,014 (GRCm39) missense probably damaging 1.00
R9554:Helz2 UTSW 2 180,882,470 (GRCm39) missense probably damaging 0.96
R9659:Helz2 UTSW 2 180,882,025 (GRCm39) missense probably benign 0.00
R9800:Helz2 UTSW 2 180,882,616 (GRCm39) missense probably damaging 0.99
X0064:Helz2 UTSW 2 180,873,534 (GRCm39) missense probably damaging 1.00
Z1176:Helz2 UTSW 2 180,879,357 (GRCm39) missense probably benign 0.39
Z1177:Helz2 UTSW 2 180,877,754 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCACACTCCAGCATTTG -3'
(R):5'- CTGCCCTATGAGTGTTCCTG -3'

Sequencing Primer
(F):5'- CTGCCTCATCGATGAAAATGTGG -3'
(R):5'- ATGAGTGTTCCTGGCATCC -3'
Posted On 2022-07-18