Incidental Mutation 'R9502:Helz2'
ID 717609
Institutional Source Beutler Lab
Gene Symbol Helz2
Ensembl Gene ENSMUSG00000027580
Gene Name helicase with zinc finger 2, transcriptional coactivator
Synonyms BC006779
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9502 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 181227615-181242027 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 181236452 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 851 (Y851F)
Ref Sequence ENSEMBL: ENSMUSP00000091756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094203] [ENSMUST00000108831] [ENSMUST00000121484]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000094203
AA Change: Y851F

PolyPhen 2 Score 0.470 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091756
Gene: ENSMUSG00000027580
AA Change: Y851F

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108831
AA Change: Y851F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104459
Gene: ENSMUSG00000027580
AA Change: Y851F

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121484
AA Change: Y851F

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112917
Gene: ENSMUSG00000027580
AA Change: Y851F

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
Pfam:AAA_11 761 877 3.9e-10 PFAM
Pfam:AAA_19 780 849 1.7e-7 PFAM
Pfam:AAA_11 870 952 2e-15 PFAM
Pfam:AAA_12 958 1162 3.8e-26 PFAM
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
Pfam:AAA_11 2400 2653 4e-42 PFAM
Pfam:AAA_12 2660 2866 2e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear transcriptional co-activator for peroxisome proliferator activated receptor alpha. The encoded protein contains a zinc finger and is a helicase that appears to be part of the peroxisome proliferator activated receptor alpha interacting complex. This gene is a member of the DNA2/NAM7 helicase gene family. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slower weight gain, hyperleptinemia, increased oxygen consumption, decreased respiratory quotient, decreased liver triglyceride level and ameliorated hyperlipidemia and hepatosteatosis when fed a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik T A 1: 52,925,503 H22L possibly damaging Het
4930452B06Rik A G 14: 8,659,452 F48L probably damaging Het
5430419D17Rik T C 7: 131,235,086 V419A possibly damaging Het
9530053A07Rik A G 7: 28,137,466 D270G probably benign Het
Abca2 C A 2: 25,436,883 Y590* probably null Het
Acot1 G T 12: 84,014,579 E220* probably null Het
Acsl5 T G 19: 55,283,312 I292S probably benign Het
Acvr1b C T 15: 101,194,829 H118Y probably benign Het
Aggf1 A G 13: 95,370,942 C112R probably benign Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Aste1 G A 9: 105,396,681 C40Y probably benign Het
Carmil1 T C 13: 24,139,374 T232A probably benign Het
Ccser2 A G 14: 36,909,133 F649L probably benign Het
Cenpf G A 1: 189,656,781 T1618I probably damaging Het
Ces5a G A 8: 93,535,680 Q10* probably null Het
Cfh A T 1: 140,112,582 L592Q possibly damaging Het
Chchd6 T C 6: 89,419,781 H216R probably damaging Het
Chrm5 A T 2: 112,480,695 H25Q probably damaging Het
Clasp2 C T 9: 113,908,798 T1080I probably benign Het
Clic6 G T 16: 92,498,700 G83C probably damaging Het
Coro1c A T 5: 113,850,720 S187R probably damaging Het
Cyp2a4 A G 7: 26,308,579 D137G probably benign Het
Ddhd1 G T 14: 45,657,222 Q264K possibly damaging Het
Dhdds A T 4: 133,980,186 Y235N probably damaging Het
Ephb1 T C 9: 102,041,287 E341G probably damaging Het
Fam53b T C 7: 132,760,011 D96G probably benign Het
Fermt1 G T 2: 132,939,468 R67S probably benign Het
Fmnl2 C A 2: 53,108,300 P559H unknown Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Frmpd2 T A 14: 33,505,447 F261I probably benign Het
Garem2 T A 5: 30,116,752 L703Q possibly damaging Het
Ggct T A 6: 54,985,887 I180F possibly damaging Het
Gigyf2 T A 1: 87,403,724 I198K unknown Het
Gucy2d T C 7: 98,458,735 F700L probably benign Het
Gucy2g T A 19: 55,210,384 I776F probably damaging Het
Has1 T C 17: 17,843,709 Y556C probably damaging Het
Hecw1 T C 13: 14,371,982 I145V probably damaging Het
Hes7 C A 11: 69,122,885 P190Q probably benign Het
Hist1h2ae T C 13: 23,570,871 I80V probably benign Het
Hivep1 T C 13: 42,169,303 C79R Het
Hnrnpr A G 4: 136,329,370 D227G probably damaging Het
Hoxb9 C A 11: 96,271,718 F59L probably benign Het
Hspb1 A T 5: 135,889,076 H135L probably benign Het
Igkv1-122 T A 6: 68,017,364 F79I probably benign Het
Igtp G C 11: 58,206,974 V324L possibly damaging Het
Il18r1 G A 1: 40,489,692 A299T probably benign Het
Kat14 C A 2: 144,393,607 P329Q probably damaging Het
Krt33b T A 11: 100,026,489 Q179L probably benign Het
Lrrk2 C T 15: 91,723,162 A576V probably damaging Het
Map3k11 A G 19: 5,690,596 E117G probably damaging Het
Mettl7a1 T C 15: 100,305,334 V163A probably damaging Het
Mgme1 C T 2: 144,272,236 A86V probably benign Het
Mks1 C A 11: 87,862,940 A534E probably damaging Het
Mrpl28 T A 17: 26,124,620 I118N probably damaging Het
Mrps22 T A 9: 98,598,166 Y102F probably damaging Het
Myt1 A T 2: 181,820,198 H1000L probably damaging Het
Ncoa5 A G 2: 165,012,882 Y107H possibly damaging Het
Nipsnap3a A T 4: 52,994,039 Y40F probably benign Het
Nlrc4 T A 17: 74,445,585 Y601F probably benign Het
Obsl1 A G 1: 75,489,623 L1487P probably damaging Het
Oit3 A T 10: 59,428,351 N320K probably damaging Het
Olfr1354 A G 10: 78,917,725 N295S probably damaging Het
Olfr393 T C 11: 73,847,999 N42S probably damaging Het
Otud4 T C 8: 79,673,851 S1065P probably benign Het
P3h1 A C 4: 119,236,811 E221A possibly damaging Het
Pgpep1 C A 8: 70,651,249 A124S probably benign Het
Pigg T A 5: 108,347,916 S940T Het
Proser3 G T 7: 30,546,162 T139K possibly damaging Het
Prr36 C T 8: 4,214,775 R297H unknown Het
Rai14 A T 15: 10,587,861 F306I possibly damaging Het
Rnase13 T A 14: 51,922,368 N105Y probably damaging Het
Ros1 A G 10: 52,124,078 I1138T probably benign Het
Rsbn1 C A 3: 103,914,830 T127K possibly damaging Het
Rsf1 G GCCGGCGGCC 7: 97,579,909 probably benign Het
Rtca T C 3: 116,507,764 T45A probably benign Het
Sema6b G T 17: 56,132,500 D82E probably benign Het
Serpinc1 A T 1: 160,993,609 K209* probably null Het
Slc4a1 C A 11: 102,356,848 R403L probably damaging Het
Smtn A G 11: 3,532,780 V92A possibly damaging Het
Spag9 T C 11: 94,068,966 V327A probably damaging Het
Spdl1 T C 11: 34,822,456 N233S possibly damaging Het
Ston2 T C 12: 91,740,650 D62G possibly damaging Het
Sult2a5 A G 7: 13,625,318 D73G probably benign Het
Ticrr A G 7: 79,693,849 E1154G probably benign Het
Tmem110 A G 14: 30,871,506 N189S probably damaging Het
Tmem163 A T 1: 127,552,792 M111K probably damaging Het
Tmem266 T C 9: 55,437,689 V535A probably damaging Het
Tmprss7 T A 16: 45,664,192 D535V probably damaging Het
Tpcn1 A C 5: 120,560,325 I44S probably benign Het
Trbv12-1 T A 6: 41,113,987 F98I probably damaging Het
Trhde A T 10: 114,800,792 V170E probably damaging Het
Trpt1 A T 19: 6,998,210 T111S probably benign Het
Ttc13 T C 8: 124,683,271 T401A possibly damaging Het
Ulbp1 T C 10: 7,473,260 I28V probably benign Het
Vldlr A T 19: 27,241,342 D531V probably damaging Het
Vmn2r85 T A 10: 130,425,518 T317S probably damaging Het
Vps33a T C 5: 123,558,642 K316R probably benign Het
Vwa3b A G 1: 37,060,439 N245S probably damaging Het
Zfp266 A T 9: 20,502,117 C82* probably null Het
Zfp746 T C 6: 48,064,463 K443R probably damaging Het
Other mutations in Helz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Helz2 APN 2 181229702 missense probably damaging 1.00
IGL00515:Helz2 APN 2 181233006 nonsense probably null
IGL00704:Helz2 APN 2 181234385 missense probably damaging 1.00
IGL00847:Helz2 APN 2 181232245 missense possibly damaging 0.73
IGL01448:Helz2 APN 2 181233977 missense probably damaging 1.00
IGL01783:Helz2 APN 2 181232881 missense probably damaging 1.00
IGL01790:Helz2 APN 2 181238481 missense probably benign 0.29
IGL02116:Helz2 APN 2 181232185 missense probably damaging 1.00
IGL02226:Helz2 APN 2 181231690 missense probably damaging 1.00
IGL02402:Helz2 APN 2 181230911 missense probably damaging 1.00
IGL02403:Helz2 APN 2 181231022 missense probably damaging 1.00
IGL02733:Helz2 APN 2 181235026 missense probably benign 0.14
IGL02869:Helz2 APN 2 181231146 intron probably benign
IGL03003:Helz2 APN 2 181240253 missense probably damaging 1.00
IGL03060:Helz2 APN 2 181229222 critical splice donor site probably null
IGL03310:Helz2 APN 2 181231804 missense probably benign 0.00
Colby UTSW 2 181233202 missense probably damaging 1.00
ANU74:Helz2 UTSW 2 181234834 missense probably benign 0.03
R0013:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0013:Helz2 UTSW 2 181240959 missense probably benign
R0014:Helz2 UTSW 2 181240511 missense probably damaging 1.00
R0014:Helz2 UTSW 2 181240511 missense probably damaging 1.00
R0016:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0018:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0019:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0019:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0055:Helz2 UTSW 2 181228821 missense possibly damaging 0.47
R0055:Helz2 UTSW 2 181228821 missense possibly damaging 0.47
R0071:Helz2 UTSW 2 181236407 missense probably damaging 1.00
R0071:Helz2 UTSW 2 181236407 missense probably damaging 1.00
R0111:Helz2 UTSW 2 181237802 missense probably benign 0.30
R0117:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0135:Helz2 UTSW 2 181232269 missense probably damaging 1.00
R0194:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0242:Helz2 UTSW 2 181230430 missense probably damaging 1.00
R0242:Helz2 UTSW 2 181230430 missense probably damaging 1.00
R0254:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0410:Helz2 UTSW 2 181230593 missense probably damaging 1.00
R0442:Helz2 UTSW 2 181232209 missense probably damaging 0.97
R0497:Helz2 UTSW 2 181229656 missense probably damaging 0.97
R0517:Helz2 UTSW 2 181227770 missense probably benign 0.00
R0541:Helz2 UTSW 2 181234825 missense possibly damaging 0.89
R0542:Helz2 UTSW 2 181232089 missense probably damaging 1.00
R0591:Helz2 UTSW 2 181232116 missense probably damaging 0.96
R0692:Helz2 UTSW 2 181240881 missense probably benign
R0826:Helz2 UTSW 2 181240853 missense possibly damaging 0.51
R0834:Helz2 UTSW 2 181230777 missense probably damaging 1.00
R0880:Helz2 UTSW 2 181236135 missense probably benign
R1170:Helz2 UTSW 2 181229815 missense probably damaging 1.00
R1186:Helz2 UTSW 2 181231128 missense probably damaging 1.00
R1344:Helz2 UTSW 2 181237596 missense possibly damaging 0.89
R1358:Helz2 UTSW 2 181232981 missense probably damaging 1.00
R1436:Helz2 UTSW 2 181235524 missense probably damaging 0.99
R1464:Helz2 UTSW 2 181239654 missense probably damaging 1.00
R1464:Helz2 UTSW 2 181239654 missense probably damaging 1.00
R1466:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1466:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1477:Helz2 UTSW 2 181232804 missense probably benign 0.00
R1564:Helz2 UTSW 2 181233228 missense probably benign 0.01
R1584:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1655:Helz2 UTSW 2 181234147 missense probably damaging 0.99
R1757:Helz2 UTSW 2 181236263 missense probably damaging 1.00
R1779:Helz2 UTSW 2 181234987 missense probably benign
R1779:Helz2 UTSW 2 181238459 missense possibly damaging 0.84
R1837:Helz2 UTSW 2 181229289 missense probably damaging 1.00
R1845:Helz2 UTSW 2 181232085 missense probably benign 0.02
R1894:Helz2 UTSW 2 181234289 missense probably damaging 1.00
R1913:Helz2 UTSW 2 181233750 missense probably damaging 1.00
R2005:Helz2 UTSW 2 181231329 missense probably benign 0.45
R2034:Helz2 UTSW 2 181232578 missense probably damaging 1.00
R2036:Helz2 UTSW 2 181237479 missense probably benign 0.03
R2061:Helz2 UTSW 2 181240544 missense probably damaging 1.00
R2088:Helz2 UTSW 2 181235102 missense probably benign 0.07
R2142:Helz2 UTSW 2 181231380 missense probably benign
R2180:Helz2 UTSW 2 181233732 missense probably damaging 1.00
R2192:Helz2 UTSW 2 181229048 nonsense probably null
R2248:Helz2 UTSW 2 181233433 missense probably benign 0.33
R2495:Helz2 UTSW 2 181232912 missense probably damaging 0.99
R2886:Helz2 UTSW 2 181240742 missense probably benign
R3617:Helz2 UTSW 2 181233061 missense probably damaging 1.00
R3776:Helz2 UTSW 2 181240389 nonsense probably null
R3803:Helz2 UTSW 2 181239996 missense probably damaging 0.96
R4043:Helz2 UTSW 2 181229710 missense probably benign 0.00
R4052:Helz2 UTSW 2 181240475 missense probably damaging 1.00
R4232:Helz2 UTSW 2 181229902 missense probably damaging 1.00
R4521:Helz2 UTSW 2 181228833 missense probably benign
R4624:Helz2 UTSW 2 181239308 missense probably damaging 0.99
R4720:Helz2 UTSW 2 181238417 missense probably damaging 1.00
R4831:Helz2 UTSW 2 181237417 missense probably damaging 1.00
R4852:Helz2 UTSW 2 181230120 missense probably damaging 1.00
R4894:Helz2 UTSW 2 181236147 missense probably benign 0.01
R4915:Helz2 UTSW 2 181232438 missense possibly damaging 0.80
R4965:Helz2 UTSW 2 181240916 missense possibly damaging 0.79
R5022:Helz2 UTSW 2 181240569 missense probably benign
R5089:Helz2 UTSW 2 181235149 missense probably benign 0.14
R5190:Helz2 UTSW 2 181230757 critical splice donor site probably null
R5309:Helz2 UTSW 2 181234846 missense probably benign 0.08
R5358:Helz2 UTSW 2 181235528 missense probably damaging 1.00
R5379:Helz2 UTSW 2 181235069 missense probably benign
R5559:Helz2 UTSW 2 181230126 missense probably damaging 0.98
R5591:Helz2 UTSW 2 181240258 missense probably damaging 0.99
R5596:Helz2 UTSW 2 181237289 intron probably benign
R5805:Helz2 UTSW 2 181240508 missense probably damaging 1.00
R5823:Helz2 UTSW 2 181236396 missense possibly damaging 0.92
R5825:Helz2 UTSW 2 181232656 missense probably benign 0.02
R5873:Helz2 UTSW 2 181234028 missense possibly damaging 0.78
R5928:Helz2 UTSW 2 181230384 missense possibly damaging 0.82
R5936:Helz2 UTSW 2 181230767 missense probably damaging 1.00
R5975:Helz2 UTSW 2 181231050 missense probably benign 0.08
R6045:Helz2 UTSW 2 181240313 missense probably benign 0.03
R6077:Helz2 UTSW 2 181233038 missense probably benign 0.41
R6218:Helz2 UTSW 2 181232294 missense probably benign 0.03
R6218:Helz2 UTSW 2 181235945 missense probably damaging 1.00
R6315:Helz2 UTSW 2 181233202 missense probably damaging 1.00
R6346:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6371:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6372:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6373:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6385:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6464:Helz2 UTSW 2 181235069 missense probably benign
R6581:Helz2 UTSW 2 181229379 missense probably damaging 0.99
R6651:Helz2 UTSW 2 181239557 nonsense probably null
R6964:Helz2 UTSW 2 181230428 missense probably damaging 1.00
R7061:Helz2 UTSW 2 181240514 missense probably damaging 1.00
R7153:Helz2 UTSW 2 181231285 missense probably benign 0.00
R7372:Helz2 UTSW 2 181238423 missense possibly damaging 0.61
R7512:Helz2 UTSW 2 181230854 missense probably benign 0.00
R7512:Helz2 UTSW 2 181235600 splice site probably null
R7583:Helz2 UTSW 2 181237572 missense probably benign 0.06
R7724:Helz2 UTSW 2 181231996 missense probably damaging 1.00
R7733:Helz2 UTSW 2 181230355 missense possibly damaging 0.63
R7748:Helz2 UTSW 2 181234531 missense probably damaging 1.00
R7774:Helz2 UTSW 2 181233991 missense probably benign
R7799:Helz2 UTSW 2 181237989 missense probably benign 0.15
R7841:Helz2 UTSW 2 181232902 missense probably damaging 1.00
R7939:Helz2 UTSW 2 181237750 missense probably damaging 0.99
R8026:Helz2 UTSW 2 181240205 missense probably benign 0.34
R8030:Helz2 UTSW 2 181237896 missense possibly damaging 0.55
R8080:Helz2 UTSW 2 181238262 missense probably damaging 0.99
R8237:Helz2 UTSW 2 181229331 missense possibly damaging 0.65
R8245:Helz2 UTSW 2 181238102 missense probably damaging 1.00
R8304:Helz2 UTSW 2 181230157 missense probably benign 0.03
R8486:Helz2 UTSW 2 181229331 missense probably damaging 1.00
R8556:Helz2 UTSW 2 181229557 missense probably damaging 1.00
R8878:Helz2 UTSW 2 181232767 missense possibly damaging 0.67
R8907:Helz2 UTSW 2 181233127 missense possibly damaging 0.47
R8911:Helz2 UTSW 2 181238380 missense
R8953:Helz2 UTSW 2 181233091 missense probably damaging 1.00
R8963:Helz2 UTSW 2 181229614 missense probably damaging 1.00
R8969:Helz2 UTSW 2 181237788 missense probably benign 0.19
R8976:Helz2 UTSW 2 181234693 missense possibly damaging 0.46
R9015:Helz2 UTSW 2 181228999 missense probably damaging 1.00
R9031:Helz2 UTSW 2 181232468 missense possibly damaging 0.78
R9052:Helz2 UTSW 2 181240175 missense possibly damaging 0.78
R9089:Helz2 UTSW 2 181239640 missense probably damaging 1.00
R9145:Helz2 UTSW 2 181240055 missense probably damaging 1.00
R9185:Helz2 UTSW 2 181230090 missense probably benign
R9186:Helz2 UTSW 2 181234664 missense possibly damaging 0.57
R9373:Helz2 UTSW 2 181240948 missense probably benign
R9407:Helz2 UTSW 2 181240182 missense probably benign 0.01
R9465:Helz2 UTSW 2 181232917 missense probably benign 0.01
R9538:Helz2 UTSW 2 181240221 missense probably damaging 1.00
R9554:Helz2 UTSW 2 181240677 missense probably damaging 0.96
R9659:Helz2 UTSW 2 181240232 missense probably benign 0.00
R9800:Helz2 UTSW 2 181240823 missense probably damaging 0.99
X0064:Helz2 UTSW 2 181231741 missense probably damaging 1.00
Z1176:Helz2 UTSW 2 181237564 missense probably benign 0.39
Z1177:Helz2 UTSW 2 181235961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCACACTCCAGCATTTG -3'
(R):5'- CTGCCCTATGAGTGTTCCTG -3'

Sequencing Primer
(F):5'- CTGCCTCATCGATGAAAATGTGG -3'
(R):5'- ATGAGTGTTCCTGGCATCC -3'
Posted On 2022-07-18