Incidental Mutation 'R9502:Chchd6'
ID 717627
Institutional Source Beutler Lab
Gene Symbol Chchd6
Ensembl Gene ENSMUSG00000030086
Gene Name coiled-coil-helix-coiled-coil-helix domain containing 6
Synonyms 1700021B03Rik, 0710001P09Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R9502 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 89383146-89595652 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 89419781 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 216 (H216R)
Ref Sequence ENSEMBL: ENSMUSP00000032172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032172] [ENSMUST00000113550]
AlphaFold Q91VN4
Predicted Effect probably damaging
Transcript: ENSMUST00000032172
AA Change: H216R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032172
Gene: ENSMUSG00000030086
AA Change: H216R

DomainStartEndE-ValueType
Pfam:DUF737 16 227 1.5e-55 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113550
AA Change: H188R

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109179
Gene: ENSMUSG00000030086
AA Change: H188R

DomainStartEndE-ValueType
Pfam:DUF737 16 179 4.8e-47 PFAM
Pfam:DUF737 173 199 9.6e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik T A 1: 52,925,503 H22L possibly damaging Het
4930452B06Rik A G 14: 8,659,452 F48L probably damaging Het
5430419D17Rik T C 7: 131,235,086 V419A possibly damaging Het
9530053A07Rik A G 7: 28,137,466 D270G probably benign Het
Abca2 C A 2: 25,436,883 Y590* probably null Het
Acot1 G T 12: 84,014,579 E220* probably null Het
Acsl5 T G 19: 55,283,312 I292S probably benign Het
Acvr1b C T 15: 101,194,829 H118Y probably benign Het
Aggf1 A G 13: 95,370,942 C112R probably benign Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Aste1 G A 9: 105,396,681 C40Y probably benign Het
Carmil1 T C 13: 24,139,374 T232A probably benign Het
Ccser2 A G 14: 36,909,133 F649L probably benign Het
Cenpf G A 1: 189,656,781 T1618I probably damaging Het
Ces5a G A 8: 93,535,680 Q10* probably null Het
Cfh A T 1: 140,112,582 L592Q possibly damaging Het
Chrm5 A T 2: 112,480,695 H25Q probably damaging Het
Clasp2 C T 9: 113,908,798 T1080I probably benign Het
Clic6 G T 16: 92,498,700 G83C probably damaging Het
Coro1c A T 5: 113,850,720 S187R probably damaging Het
Cyp2a4 A G 7: 26,308,579 D137G probably benign Het
Ddhd1 G T 14: 45,657,222 Q264K possibly damaging Het
Dhdds A T 4: 133,980,186 Y235N probably damaging Het
Ephb1 T C 9: 102,041,287 E341G probably damaging Het
Fam53b T C 7: 132,760,011 D96G probably benign Het
Fermt1 G T 2: 132,939,468 R67S probably benign Het
Fmnl2 C A 2: 53,108,300 P559H unknown Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Frmpd2 T A 14: 33,505,447 F261I probably benign Het
Garem2 T A 5: 30,116,752 L703Q possibly damaging Het
Ggct T A 6: 54,985,887 I180F possibly damaging Het
Gigyf2 T A 1: 87,403,724 I198K unknown Het
Gucy2d T C 7: 98,458,735 F700L probably benign Het
Gucy2g T A 19: 55,210,384 I776F probably damaging Het
Has1 T C 17: 17,843,709 Y556C probably damaging Het
Hecw1 T C 13: 14,371,982 I145V probably damaging Het
Helz2 T A 2: 181,236,452 Y851F possibly damaging Het
Hes7 C A 11: 69,122,885 P190Q probably benign Het
Hist1h2ae T C 13: 23,570,871 I80V probably benign Het
Hivep1 T C 13: 42,169,303 C79R Het
Hnrnpr A G 4: 136,329,370 D227G probably damaging Het
Hoxb9 C A 11: 96,271,718 F59L probably benign Het
Hspb1 A T 5: 135,889,076 H135L probably benign Het
Igkv1-122 T A 6: 68,017,364 F79I probably benign Het
Igtp G C 11: 58,206,974 V324L possibly damaging Het
Il18r1 G A 1: 40,489,692 A299T probably benign Het
Kat14 C A 2: 144,393,607 P329Q probably damaging Het
Krt33b T A 11: 100,026,489 Q179L probably benign Het
Lrrk2 C T 15: 91,723,162 A576V probably damaging Het
Map3k11 A G 19: 5,690,596 E117G probably damaging Het
Mettl7a1 T C 15: 100,305,334 V163A probably damaging Het
Mgme1 C T 2: 144,272,236 A86V probably benign Het
Mks1 C A 11: 87,862,940 A534E probably damaging Het
Mrpl28 T A 17: 26,124,620 I118N probably damaging Het
Mrps22 T A 9: 98,598,166 Y102F probably damaging Het
Myt1 A T 2: 181,820,198 H1000L probably damaging Het
Ncoa5 A G 2: 165,012,882 Y107H possibly damaging Het
Nipsnap3a A T 4: 52,994,039 Y40F probably benign Het
Nlrc4 T A 17: 74,445,585 Y601F probably benign Het
Obsl1 A G 1: 75,489,623 L1487P probably damaging Het
Oit3 A T 10: 59,428,351 N320K probably damaging Het
Olfr1354 A G 10: 78,917,725 N295S probably damaging Het
Olfr393 T C 11: 73,847,999 N42S probably damaging Het
Otud4 T C 8: 79,673,851 S1065P probably benign Het
P3h1 A C 4: 119,236,811 E221A possibly damaging Het
Pgpep1 C A 8: 70,651,249 A124S probably benign Het
Pigg T A 5: 108,347,916 S940T Het
Proser3 G T 7: 30,546,162 T139K possibly damaging Het
Prr36 C T 8: 4,214,775 R297H unknown Het
Rai14 A T 15: 10,587,861 F306I possibly damaging Het
Rnase13 T A 14: 51,922,368 N105Y probably damaging Het
Ros1 A G 10: 52,124,078 I1138T probably benign Het
Rsbn1 C A 3: 103,914,830 T127K possibly damaging Het
Rsf1 G GCCGGCGGCC 7: 97,579,909 probably benign Het
Rtca T C 3: 116,507,764 T45A probably benign Het
Sema6b G T 17: 56,132,500 D82E probably benign Het
Serpinc1 A T 1: 160,993,609 K209* probably null Het
Slc4a1 C A 11: 102,356,848 R403L probably damaging Het
Smtn A G 11: 3,532,780 V92A possibly damaging Het
Spag9 T C 11: 94,068,966 V327A probably damaging Het
Spdl1 T C 11: 34,822,456 N233S possibly damaging Het
Ston2 T C 12: 91,740,650 D62G possibly damaging Het
Sult2a5 A G 7: 13,625,318 D73G probably benign Het
Ticrr A G 7: 79,693,849 E1154G probably benign Het
Tmem110 A G 14: 30,871,506 N189S probably damaging Het
Tmem163 A T 1: 127,552,792 M111K probably damaging Het
Tmem266 T C 9: 55,437,689 V535A probably damaging Het
Tmprss7 T A 16: 45,664,192 D535V probably damaging Het
Tpcn1 A C 5: 120,560,325 I44S probably benign Het
Trbv12-1 T A 6: 41,113,987 F98I probably damaging Het
Trhde A T 10: 114,800,792 V170E probably damaging Het
Trpt1 A T 19: 6,998,210 T111S probably benign Het
Ttc13 T C 8: 124,683,271 T401A possibly damaging Het
Ulbp1 T C 10: 7,473,260 I28V probably benign Het
Vldlr A T 19: 27,241,342 D531V probably damaging Het
Vmn2r85 T A 10: 130,425,518 T317S probably damaging Het
Vps33a T C 5: 123,558,642 K316R probably benign Het
Vwa3b A G 1: 37,060,439 N245S probably damaging Het
Zfp266 A T 9: 20,502,117 C82* probably null Het
Zfp746 T C 6: 48,064,463 K443R probably damaging Het
Other mutations in Chchd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Chchd6 APN 6 89569417 splice site probably null
IGL02340:Chchd6 APN 6 89419780 missense probably damaging 0.99
IGL02490:Chchd6 APN 6 89384674 missense possibly damaging 0.90
R0557:Chchd6 UTSW 6 89574587 missense probably damaging 1.00
R1170:Chchd6 UTSW 6 89384687 missense probably damaging 1.00
R1341:Chchd6 UTSW 6 89384641 missense probably benign 0.00
R1619:Chchd6 UTSW 6 89419754 missense possibly damaging 0.95
R1757:Chchd6 UTSW 6 89384644 missense probably damaging 1.00
R3886:Chchd6 UTSW 6 89467451 missense probably damaging 1.00
R4627:Chchd6 UTSW 6 89384660 missense probably damaging 1.00
R4635:Chchd6 UTSW 6 89467466 missense probably damaging 1.00
R5518:Chchd6 UTSW 6 89567585 critical splice donor site probably null
R6732:Chchd6 UTSW 6 89574454 missense probably benign 0.03
R6869:Chchd6 UTSW 6 89595496 missense probably damaging 1.00
R8673:Chchd6 UTSW 6 89569398 missense probably damaging 0.98
R9365:Chchd6 UTSW 6 89574431 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GGGTAATTACTGATGGCCAATG -3'
(R):5'- AAGTGATCAGCATGCCATGGG -3'

Sequencing Primer
(F):5'- GCCAATGGCTACCTTCAGC -3'
(R):5'- TCAGCATGCCATGGGAGCTAG -3'
Posted On 2022-07-18