Incidental Mutation 'R9502:Lrrk2'
ID 717680
Institutional Source Beutler Lab
Gene Symbol Lrrk2
Ensembl Gene ENSMUSG00000036273
Gene Name leucine-rich repeat kinase 2
Synonyms 9330188B09Rik, 4921513O20Rik, LOC381026, cI-46, D630001M17Rik
Accession Numbers

Genbank: NM_025730; MGI: 1913975

Is this an essential gene? Possibly non essential (E-score: 0.367) question?
Stock # R9502 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 91673175-91816120 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 91723162 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 576 (A576V)
Ref Sequence ENSEMBL: ENSMUSP00000052584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060642]
AlphaFold Q5S006
Predicted Effect probably damaging
Transcript: ENSMUST00000060642
AA Change: A576V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052584
Gene: ENSMUSG00000036273
AA Change: A576V

DomainStartEndE-ValueType
low complexity region 138 156 N/A INTRINSIC
low complexity region 332 347 N/A INTRINSIC
ANK 708 737 3.95e1 SMART
ANK 770 800 4.58e2 SMART
low complexity region 890 901 N/A INTRINSIC
low complexity region 953 966 N/A INTRINSIC
low complexity region 971 979 N/A INTRINSIC
LRR 1010 1033 9.96e-1 SMART
LRR 1034 1057 8.01e0 SMART
LRR 1082 1105 2.45e0 SMART
LRR 1128 1151 9.3e-1 SMART
LRR 1195 1219 3.24e0 SMART
LRR 1244 1266 3.87e1 SMART
LRR 1267 1291 4.98e1 SMART
Pfam:Roc 1336 1456 4.9e-32 PFAM
Pfam:Ras 1336 1489 3.3e-17 PFAM
Pfam:COR 1524 1740 4e-28 PFAM
Pfam:Pkinase 1881 2132 4.7e-40 PFAM
Pfam:Pkinase_Tyr 1882 2132 6.8e-39 PFAM
WD40 2231 2276 3.09e-1 SMART
WD40 2401 2438 1.37e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired response to dopamine, amphetamine, and quinpirole. Mice homozygous for one knock-out allele exhibit increased neurite growth. Mice homozygous for different knock-out alleles exhibit alopecia due to excessive grooming or kdiney atrophy. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(6) Targeted, other(1)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik T A 1: 52,925,503 H22L possibly damaging Het
4930452B06Rik A G 14: 8,659,452 F48L probably damaging Het
5430419D17Rik T C 7: 131,235,086 V419A possibly damaging Het
9530053A07Rik A G 7: 28,137,466 D270G probably benign Het
Abca2 C A 2: 25,436,883 Y590* probably null Het
Acot1 G T 12: 84,014,579 E220* probably null Het
Acsl5 T G 19: 55,283,312 I292S probably benign Het
Acvr1b C T 15: 101,194,829 H118Y probably benign Het
Aggf1 A G 13: 95,370,942 C112R probably benign Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Aste1 G A 9: 105,396,681 C40Y probably benign Het
Carmil1 T C 13: 24,139,374 T232A probably benign Het
Ccser2 A G 14: 36,909,133 F649L probably benign Het
Cenpf G A 1: 189,656,781 T1618I probably damaging Het
Ces5a G A 8: 93,535,680 Q10* probably null Het
Cfh A T 1: 140,112,582 L592Q possibly damaging Het
Chchd6 T C 6: 89,419,781 H216R probably damaging Het
Chrm5 A T 2: 112,480,695 H25Q probably damaging Het
Clasp2 C T 9: 113,908,798 T1080I probably benign Het
Clic6 G T 16: 92,498,700 G83C probably damaging Het
Coro1c A T 5: 113,850,720 S187R probably damaging Het
Cyp2a4 A G 7: 26,308,579 D137G probably benign Het
Ddhd1 G T 14: 45,657,222 Q264K possibly damaging Het
Dhdds A T 4: 133,980,186 Y235N probably damaging Het
Ephb1 T C 9: 102,041,287 E341G probably damaging Het
Fam53b T C 7: 132,760,011 D96G probably benign Het
Fermt1 G T 2: 132,939,468 R67S probably benign Het
Fmnl2 C A 2: 53,108,300 P559H unknown Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Frmpd2 T A 14: 33,505,447 F261I probably benign Het
Garem2 T A 5: 30,116,752 L703Q possibly damaging Het
Ggct T A 6: 54,985,887 I180F possibly damaging Het
Gigyf2 T A 1: 87,403,724 I198K unknown Het
Gucy2d T C 7: 98,458,735 F700L probably benign Het
Gucy2g T A 19: 55,210,384 I776F probably damaging Het
Has1 T C 17: 17,843,709 Y556C probably damaging Het
Hecw1 T C 13: 14,371,982 I145V probably damaging Het
Helz2 T A 2: 181,236,452 Y851F possibly damaging Het
Hes7 C A 11: 69,122,885 P190Q probably benign Het
Hist1h2ae T C 13: 23,570,871 I80V probably benign Het
Hivep1 T C 13: 42,169,303 C79R Het
Hnrnpr A G 4: 136,329,370 D227G probably damaging Het
Hoxb9 C A 11: 96,271,718 F59L probably benign Het
Hspb1 A T 5: 135,889,076 H135L probably benign Het
Igkv1-122 T A 6: 68,017,364 F79I probably benign Het
Igtp G C 11: 58,206,974 V324L possibly damaging Het
Il18r1 G A 1: 40,489,692 A299T probably benign Het
Kat14 C A 2: 144,393,607 P329Q probably damaging Het
Krt33b T A 11: 100,026,489 Q179L probably benign Het
Map3k11 A G 19: 5,690,596 E117G probably damaging Het
Mettl7a1 T C 15: 100,305,334 V163A probably damaging Het
Mgme1 C T 2: 144,272,236 A86V probably benign Het
Mks1 C A 11: 87,862,940 A534E probably damaging Het
Mrpl28 T A 17: 26,124,620 I118N probably damaging Het
Mrps22 T A 9: 98,598,166 Y102F probably damaging Het
Myt1 A T 2: 181,820,198 H1000L probably damaging Het
Ncoa5 A G 2: 165,012,882 Y107H possibly damaging Het
Nipsnap3a A T 4: 52,994,039 Y40F probably benign Het
Nlrc4 T A 17: 74,445,585 Y601F probably benign Het
Obsl1 A G 1: 75,489,623 L1487P probably damaging Het
Oit3 A T 10: 59,428,351 N320K probably damaging Het
Olfr1354 A G 10: 78,917,725 N295S probably damaging Het
Olfr393 T C 11: 73,847,999 N42S probably damaging Het
Otud4 T C 8: 79,673,851 S1065P probably benign Het
P3h1 A C 4: 119,236,811 E221A possibly damaging Het
Pgpep1 C A 8: 70,651,249 A124S probably benign Het
Pigg T A 5: 108,347,916 S940T Het
Proser3 G T 7: 30,546,162 T139K possibly damaging Het
Prr36 C T 8: 4,214,775 R297H unknown Het
Rai14 A T 15: 10,587,861 F306I possibly damaging Het
Rnase13 T A 14: 51,922,368 N105Y probably damaging Het
Ros1 A G 10: 52,124,078 I1138T probably benign Het
Rsbn1 C A 3: 103,914,830 T127K possibly damaging Het
Rsf1 G GCCGGCGGCC 7: 97,579,909 probably benign Het
Rtca T C 3: 116,507,764 T45A probably benign Het
Sema6b G T 17: 56,132,500 D82E probably benign Het
Serpinc1 A T 1: 160,993,609 K209* probably null Het
Slc4a1 C A 11: 102,356,848 R403L probably damaging Het
Smtn A G 11: 3,532,780 V92A possibly damaging Het
Spag9 T C 11: 94,068,966 V327A probably damaging Het
Spdl1 T C 11: 34,822,456 N233S possibly damaging Het
Ston2 T C 12: 91,740,650 D62G possibly damaging Het
Sult2a5 A G 7: 13,625,318 D73G probably benign Het
Ticrr A G 7: 79,693,849 E1154G probably benign Het
Tmem110 A G 14: 30,871,506 N189S probably damaging Het
Tmem163 A T 1: 127,552,792 M111K probably damaging Het
Tmem266 T C 9: 55,437,689 V535A probably damaging Het
Tmprss7 T A 16: 45,664,192 D535V probably damaging Het
Tpcn1 A C 5: 120,560,325 I44S probably benign Het
Trbv12-1 T A 6: 41,113,987 F98I probably damaging Het
Trhde A T 10: 114,800,792 V170E probably damaging Het
Trpt1 A T 19: 6,998,210 T111S probably benign Het
Ttc13 T C 8: 124,683,271 T401A possibly damaging Het
Ulbp1 T C 10: 7,473,260 I28V probably benign Het
Vldlr A T 19: 27,241,342 D531V probably damaging Het
Vmn2r85 T A 10: 130,425,518 T317S probably damaging Het
Vps33a T C 5: 123,558,642 K316R probably benign Het
Vwa3b A G 1: 37,060,439 N245S probably damaging Het
Zfp266 A T 9: 20,502,117 C82* probably null Het
Zfp746 T C 6: 48,064,463 K443R probably damaging Het
Other mutations in Lrrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Lrrk2 APN 15 91747799 missense possibly damaging 0.90
IGL00542:Lrrk2 APN 15 91699943 missense probably benign
IGL00770:Lrrk2 APN 15 91801833 splice site probably benign
IGL00774:Lrrk2 APN 15 91801833 splice site probably benign
IGL00791:Lrrk2 APN 15 91779841 missense probably damaging 1.00
IGL00827:Lrrk2 APN 15 91755790 missense probably damaging 1.00
IGL00843:Lrrk2 APN 15 91757058 missense possibly damaging 0.58
IGL01109:Lrrk2 APN 15 91738832 missense probably damaging 1.00
IGL01293:Lrrk2 APN 15 91726137 missense probably benign 0.21
IGL01296:Lrrk2 APN 15 91683142 missense probably benign
IGL01301:Lrrk2 APN 15 91767339 missense probably damaging 1.00
IGL01360:Lrrk2 APN 15 91700569 splice site probably null
IGL01465:Lrrk2 APN 15 91728925 missense probably benign 0.21
IGL01529:Lrrk2 APN 15 91812313 missense possibly damaging 0.92
IGL01557:Lrrk2 APN 15 91699989 missense probably damaging 1.00
IGL01560:Lrrk2 APN 15 91774988 missense probably benign 0.33
IGL01991:Lrrk2 APN 15 91779946 missense probably damaging 0.99
IGL02003:Lrrk2 APN 15 91731491 missense probably damaging 0.99
IGL02325:Lrrk2 APN 15 91726308 critical splice donor site probably null
IGL02711:Lrrk2 APN 15 91685822 missense possibly damaging 0.71
IGL02869:Lrrk2 APN 15 91750277 missense probably damaging 1.00
IGL03104:Lrrk2 APN 15 91747755 missense possibly damaging 0.68
IGL03179:Lrrk2 APN 15 91700578 missense probably damaging 1.00
IGL03395:Lrrk2 APN 15 91797414 splice site probably null
horned UTSW 15 91772858 missense probably damaging 1.00
R1312_Lrrk2_980 UTSW 15 91699895 missense probably damaging 1.00
R4710_lrrk2_232 UTSW 15 91699927 missense possibly damaging 0.88
R5245_Lrrk2_127 UTSW 15 91796089 missense probably damaging 1.00
spree UTSW 15 91702247 missense probably benign 0.00
Spur UTSW 15 91774995 nonsense probably null
3-1:Lrrk2 UTSW 15 91801934 missense probably benign 0.01
ANU18:Lrrk2 UTSW 15 91767339 missense probably damaging 1.00
H8562:Lrrk2 UTSW 15 91673358 missense probably benign
H8786:Lrrk2 UTSW 15 91673358 missense probably benign
IGL02835:Lrrk2 UTSW 15 91814660 critical splice acceptor site probably null
R0014:Lrrk2 UTSW 15 91802045 splice site probably benign
R0014:Lrrk2 UTSW 15 91802045 splice site probably benign
R0078:Lrrk2 UTSW 15 91734009 missense probably benign 0.01
R0100:Lrrk2 UTSW 15 91745796 missense probably damaging 1.00
R0282:Lrrk2 UTSW 15 91778414 splice site probably benign
R0448:Lrrk2 UTSW 15 91709305 missense probably damaging 0.99
R0449:Lrrk2 UTSW 15 91750275 missense probably damaging 1.00
R0610:Lrrk2 UTSW 15 91815416 missense probably benign
R0617:Lrrk2 UTSW 15 91752278 missense probably benign 0.00
R0632:Lrrk2 UTSW 15 91796028 missense probably damaging 0.98
R0639:Lrrk2 UTSW 15 91772996 missense probably benign 0.03
R0661:Lrrk2 UTSW 15 91787016 missense probably damaging 1.00
R0666:Lrrk2 UTSW 15 91757070 critical splice donor site probably null
R0764:Lrrk2 UTSW 15 91775046 splice site probably null
R0766:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R0845:Lrrk2 UTSW 15 91755962 missense probably benign 0.22
R0940:Lrrk2 UTSW 15 91729081 missense possibly damaging 0.83
R0970:Lrrk2 UTSW 15 91729169 missense probably benign 0.22
R1080:Lrrk2 UTSW 15 91673689 missense probably benign 0.01
R1114:Lrrk2 UTSW 15 91700468 nonsense probably null
R1223:Lrrk2 UTSW 15 91673635 missense probably benign 0.00
R1289:Lrrk2 UTSW 15 91812360 missense probably benign 0.00
R1296:Lrrk2 UTSW 15 91728920 missense probably damaging 1.00
R1312:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R1637:Lrrk2 UTSW 15 91734058 missense probably benign
R1773:Lrrk2 UTSW 15 91779981 missense possibly damaging 0.96
R1809:Lrrk2 UTSW 15 91699892 missense possibly damaging 0.86
R1839:Lrrk2 UTSW 15 91683134 missense probably benign 0.00
R1946:Lrrk2 UTSW 15 91736661 splice site probably null
R2160:Lrrk2 UTSW 15 91796060 missense probably damaging 1.00
R2232:Lrrk2 UTSW 15 91764716 missense probably benign 0.05
R2419:Lrrk2 UTSW 15 91797526 splice site probably benign
R2516:Lrrk2 UTSW 15 91755927 missense probably benign
R3110:Lrrk2 UTSW 15 91814695 missense probably benign 0.02
R3112:Lrrk2 UTSW 15 91814695 missense probably benign 0.02
R3801:Lrrk2 UTSW 15 91737111 missense probably benign
R3842:Lrrk2 UTSW 15 91755916 missense probably benign 0.01
R3903:Lrrk2 UTSW 15 91747700 missense probably damaging 1.00
R3903:Lrrk2 UTSW 15 91747701 missense probably damaging 1.00
R3930:Lrrk2 UTSW 15 91767461 critical splice donor site probably null
R3937:Lrrk2 UTSW 15 91778504 missense probably damaging 0.98
R3938:Lrrk2 UTSW 15 91712780 missense possibly damaging 0.69
R3938:Lrrk2 UTSW 15 91778504 missense probably damaging 0.98
R3982:Lrrk2 UTSW 15 91709284 missense probably benign 0.22
R4125:Lrrk2 UTSW 15 91815483 missense probably benign 0.01
R4130:Lrrk2 UTSW 15 91755794 missense probably benign 0.19
R4296:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R4465:Lrrk2 UTSW 15 91747820 missense probably damaging 0.96
R4478:Lrrk2 UTSW 15 91723188 missense probably damaging 1.00
R4517:Lrrk2 UTSW 15 91705120 missense probably benign
R4539:Lrrk2 UTSW 15 91729142 missense possibly damaging 0.86
R4654:Lrrk2 UTSW 15 91765681 missense probably damaging 0.96
R4710:Lrrk2 UTSW 15 91699927 missense possibly damaging 0.88
R4722:Lrrk2 UTSW 15 91688901 missense probably damaging 1.00
R4723:Lrrk2 UTSW 15 91764759 missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91688849 missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91765747 missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91688849 missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91765747 missense probably damaging 1.00
R4787:Lrrk2 UTSW 15 91712828 missense probably benign
R4945:Lrrk2 UTSW 15 91804920 missense probably benign 0.02
R4948:Lrrk2 UTSW 15 91803389 missense probably benign 0.20
R5000:Lrrk2 UTSW 15 91749878 missense probably damaging 1.00
R5031:Lrrk2 UTSW 15 91700619 missense possibly damaging 0.50
R5067:Lrrk2 UTSW 15 91765790 missense probably benign 0.01
R5245:Lrrk2 UTSW 15 91796089 missense probably damaging 1.00
R5341:Lrrk2 UTSW 15 91772858 missense probably damaging 1.00
R5460:Lrrk2 UTSW 15 91814644 splice site probably null
R5551:Lrrk2 UTSW 15 91812350 missense probably benign
R5574:Lrrk2 UTSW 15 91787016 missense probably damaging 1.00
R5577:Lrrk2 UTSW 15 91765745 missense probably damaging 1.00
R5685:Lrrk2 UTSW 15 91803301 nonsense probably null
R5712:Lrrk2 UTSW 15 91702222 nonsense probably null
R5728:Lrrk2 UTSW 15 91774974 missense probably benign 0.36
R5782:Lrrk2 UTSW 15 91702183 missense probably damaging 1.00
R5788:Lrrk2 UTSW 15 91764648 missense possibly damaging 0.55
R5821:Lrrk2 UTSW 15 91709390 critical splice donor site probably null
R5852:Lrrk2 UTSW 15 91755949 missense probably damaging 1.00
R5934:Lrrk2 UTSW 15 91734046 missense probably benign 0.00
R5935:Lrrk2 UTSW 15 91745831 missense probably benign 0.14
R5979:Lrrk2 UTSW 15 91772945 missense possibly damaging 0.47
R6101:Lrrk2 UTSW 15 91723135 missense probably benign 0.10
R6114:Lrrk2 UTSW 15 91747826 missense probably benign 0.33
R6259:Lrrk2 UTSW 15 91702247 missense probably benign 0.00
R6376:Lrrk2 UTSW 15 91742266 missense possibly damaging 0.89
R6417:Lrrk2 UTSW 15 91812346 missense probably benign 0.03
R6420:Lrrk2 UTSW 15 91812346 missense probably benign 0.03
R6737:Lrrk2 UTSW 15 91723218 missense possibly damaging 0.50
R7056:Lrrk2 UTSW 15 91774995 nonsense probably null
R7072:Lrrk2 UTSW 15 91801920 missense probably benign 0.03
R7109:Lrrk2 UTSW 15 91764782 missense probably damaging 1.00
R7128:Lrrk2 UTSW 15 91801885 missense probably benign
R7144:Lrrk2 UTSW 15 91734055 missense possibly damaging 0.54
R7187:Lrrk2 UTSW 15 91757001 missense possibly damaging 0.92
R7270:Lrrk2 UTSW 15 91700441 missense probably benign 0.01
R7356:Lrrk2 UTSW 15 91738744 missense probably benign 0.07
R7360:Lrrk2 UTSW 15 91731655 critical splice donor site probably null
R7373:Lrrk2 UTSW 15 91700004 critical splice donor site probably null
R7465:Lrrk2 UTSW 15 91767340 missense probably damaging 1.00
R7477:Lrrk2 UTSW 15 91812325 missense probably damaging 0.98
R7614:Lrrk2 UTSW 15 91772858 missense probably damaging 1.00
R7622:Lrrk2 UTSW 15 91812323 missense probably damaging 1.00
R7658:Lrrk2 UTSW 15 91700358 missense possibly damaging 0.91
R7679:Lrrk2 UTSW 15 91726186 missense possibly damaging 0.58
R7737:Lrrk2 UTSW 15 91815446 missense probably damaging 0.98
R7739:Lrrk2 UTSW 15 91700613 missense probably damaging 1.00
R7740:Lrrk2 UTSW 15 91767324 missense probably damaging 1.00
R7908:Lrrk2 UTSW 15 91726152 missense probably damaging 1.00
R8299:Lrrk2 UTSW 15 91673240 start gained probably benign
R8389:Lrrk2 UTSW 15 91699991 missense probably damaging 1.00
R8462:Lrrk2 UTSW 15 91731477 missense probably benign
R8698:Lrrk2 UTSW 15 91752197 missense probably benign 0.38
R8947:Lrrk2 UTSW 15 91702270 nonsense probably null
R9084:Lrrk2 UTSW 15 91750266 missense
R9086:Lrrk2 UTSW 15 91755848 missense probably benign 0.01
R9096:Lrrk2 UTSW 15 91673256 start gained probably benign
R9097:Lrrk2 UTSW 15 91673256 start gained probably benign
R9267:Lrrk2 UTSW 15 91700426 missense probably damaging 0.99
R9285:Lrrk2 UTSW 15 91778483 missense probably damaging 1.00
R9341:Lrrk2 UTSW 15 91700415 missense probably benign 0.18
R9343:Lrrk2 UTSW 15 91700415 missense probably benign 0.18
R9371:Lrrk2 UTSW 15 91723204 missense probably damaging 1.00
R9424:Lrrk2 UTSW 15 91752185 nonsense probably null
R9489:Lrrk2 UTSW 15 91737217 missense probably benign 0.37
R9563:Lrrk2 UTSW 15 91749840 missense possibly damaging 0.90
R9576:Lrrk2 UTSW 15 91752185 nonsense probably null
R9605:Lrrk2 UTSW 15 91737217 missense probably benign 0.37
R9635:Lrrk2 UTSW 15 91812324 missense probably benign 0.21
R9641:Lrrk2 UTSW 15 91787048 missense possibly damaging 0.94
R9660:Lrrk2 UTSW 15 91734025 missense probably benign 0.00
R9673:Lrrk2 UTSW 15 91765681 missense probably damaging 1.00
R9708:Lrrk2 UTSW 15 91750279 nonsense probably null
R9728:Lrrk2 UTSW 15 91734025 missense probably benign 0.00
R9757:Lrrk2 UTSW 15 91811026 missense probably benign 0.03
RF001:Lrrk2 UTSW 15 91736633 missense probably benign 0.11
X0028:Lrrk2 UTSW 15 91738851 missense probably benign 0.00
Z1088:Lrrk2 UTSW 15 91726240 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGCTGCATACCCAGACATTGAATTATG -3'
(R):5'- TCTTTTAACCTTAAAGCAGAAGGAAGG -3'

Sequencing Primer
(F):5'- ACCCAGACATTGAATTATGTTTTACC -3'
(R):5'- AGTAAGTAGCATTCCTCCATGGC -3'
Posted On 2022-07-18