Incidental Mutation 'R9502:Acvr1b'
ID 717682
Institutional Source Beutler Lab
Gene Symbol Acvr1b
Ensembl Gene ENSMUSG00000000532
Gene Name activin A receptor, type 1B
Synonyms ActRIB, Acvrlk4, SKR2, Alk4, ActR-IB
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9502 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 101071953-101111565 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 101092710 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 118 (H118Y)
Ref Sequence ENSEMBL: ENSMUSP00000000544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000544]
AlphaFold Q61271
Predicted Effect probably benign
Transcript: ENSMUST00000000544
AA Change: H118Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000544
Gene: ENSMUSG00000000532
AA Change: H118Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Activin_recp 32 108 4.1e-13 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 177 207 1.89e-14 SMART
Blast:STYKc 209 494 2e-26 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an activin A type IB receptor. Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I and two type II receptors. This protein is a type I receptor which is essential for signaling. Mutations in this gene are associated with pituitary tumors. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jun 2010]
PHENOTYPE: Embryos homozygous for targeted mutations that inactivate the gene arrest at the egg cylinder stage, prior to gastrulation, showing epiblast and extraembryonic ectoderm disorganization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik T A 1: 52,964,662 (GRCm39) H22L possibly damaging Het
Abca2 C A 2: 25,326,895 (GRCm39) Y590* probably null Het
Acot1 G T 12: 84,061,353 (GRCm39) E220* probably null Het
Acsl5 T G 19: 55,271,744 (GRCm39) I292S probably benign Het
Aggf1 A G 13: 95,507,450 (GRCm39) C112R probably benign Het
Ap2a2 T A 7: 141,178,689 (GRCm39) N105K probably benign Het
Aste1 G A 9: 105,273,880 (GRCm39) C40Y probably benign Het
Carmil1 T C 13: 24,323,357 (GRCm39) T232A probably benign Het
Ccser2 A G 14: 36,631,090 (GRCm39) F649L probably benign Het
Cdcp3 T C 7: 130,836,815 (GRCm39) V419A possibly damaging Het
Cenpf G A 1: 189,388,978 (GRCm39) T1618I probably damaging Het
Ces5a G A 8: 94,262,308 (GRCm39) Q10* probably null Het
Cfap20dc A G 14: 8,659,452 (GRCm38) F48L probably damaging Het
Cfh A T 1: 140,040,320 (GRCm39) L592Q possibly damaging Het
Chchd6 T C 6: 89,396,763 (GRCm39) H216R probably damaging Het
Chrm5 A T 2: 112,311,040 (GRCm39) H25Q probably damaging Het
Clasp2 C T 9: 113,737,866 (GRCm39) T1080I probably benign Het
Clic6 G T 16: 92,295,588 (GRCm39) G83C probably damaging Het
Coro1c A T 5: 113,988,781 (GRCm39) S187R probably damaging Het
Cyp2a4 A G 7: 26,008,004 (GRCm39) D137G probably benign Het
Ddhd1 G T 14: 45,894,679 (GRCm39) Q264K possibly damaging Het
Dhdds A T 4: 133,707,497 (GRCm39) Y235N probably damaging Het
Ephb1 T C 9: 101,918,486 (GRCm39) E341G probably damaging Het
Fam53b T C 7: 132,361,740 (GRCm39) D96G probably benign Het
Fcgbpl1 A G 7: 27,836,891 (GRCm39) D270G probably benign Het
Fermt1 G T 2: 132,781,388 (GRCm39) R67S probably benign Het
Fmnl2 C A 2: 52,998,312 (GRCm39) P559H unknown Het
Foxo3 C T 10: 42,073,021 (GRCm39) V499M probably damaging Het
Frmpd2 T A 14: 33,227,404 (GRCm39) F261I probably benign Het
Garem2 T A 5: 30,321,750 (GRCm39) L703Q possibly damaging Het
Ggct T A 6: 54,962,872 (GRCm39) I180F possibly damaging Het
Gigyf2 T A 1: 87,331,446 (GRCm39) I198K unknown Het
Gucy2d T C 7: 98,107,942 (GRCm39) F700L probably benign Het
Gucy2g T A 19: 55,198,816 (GRCm39) I776F probably damaging Het
H2ac8 T C 13: 23,755,045 (GRCm39) I80V probably benign Het
Has1 T C 17: 18,063,971 (GRCm39) Y556C probably damaging Het
Hecw1 T C 13: 14,546,567 (GRCm39) I145V probably damaging Het
Helz2 T A 2: 180,878,245 (GRCm39) Y851F possibly damaging Het
Hes7 C A 11: 69,013,711 (GRCm39) P190Q probably benign Het
Hivep1 T C 13: 42,322,779 (GRCm39) C79R Het
Hnrnpr A G 4: 136,056,681 (GRCm39) D227G probably damaging Het
Hoxb9 C A 11: 96,162,544 (GRCm39) F59L probably benign Het
Hspb1 A T 5: 135,917,930 (GRCm39) H135L probably benign Het
Igkv1-122 T A 6: 67,994,348 (GRCm39) F79I probably benign Het
Igtp G C 11: 58,097,800 (GRCm39) V324L possibly damaging Het
Il18r1 G A 1: 40,528,852 (GRCm39) A299T probably benign Het
Kat14 C A 2: 144,235,527 (GRCm39) P329Q probably damaging Het
Krt33b T A 11: 99,917,315 (GRCm39) Q179L probably benign Het
Lrrk2 C T 15: 91,607,365 (GRCm39) A576V probably damaging Het
Map3k11 A G 19: 5,740,624 (GRCm39) E117G probably damaging Het
Mgme1 C T 2: 144,114,156 (GRCm39) A86V probably benign Het
Mks1 C A 11: 87,753,766 (GRCm39) A534E probably damaging Het
Mrpl28 T A 17: 26,343,594 (GRCm39) I118N probably damaging Het
Mrps22 T A 9: 98,480,219 (GRCm39) Y102F probably damaging Het
Myt1 A T 2: 181,461,991 (GRCm39) H1000L probably damaging Het
Ncoa5 A G 2: 164,854,802 (GRCm39) Y107H possibly damaging Het
Nipsnap3a A T 4: 52,994,039 (GRCm39) Y40F probably benign Het
Nlrc4 T A 17: 74,752,580 (GRCm39) Y601F probably benign Het
Obsl1 A G 1: 75,466,267 (GRCm39) L1487P probably damaging Het
Oit3 A T 10: 59,264,173 (GRCm39) N320K probably damaging Het
Or1e33 T C 11: 73,738,825 (GRCm39) N42S probably damaging Het
Or7a38 A G 10: 78,753,559 (GRCm39) N295S probably damaging Het
Otud4 T C 8: 80,400,480 (GRCm39) S1065P probably benign Het
P3h1 A C 4: 119,094,008 (GRCm39) E221A possibly damaging Het
Pgpep1 C A 8: 71,103,899 (GRCm39) A124S probably benign Het
Pigg T A 5: 108,495,782 (GRCm39) S940T Het
Proser3 G T 7: 30,245,587 (GRCm39) T139K possibly damaging Het
Prr36 C T 8: 4,264,775 (GRCm39) R297H unknown Het
Rai14 A T 15: 10,587,947 (GRCm39) F306I possibly damaging Het
Rnase13 T A 14: 52,159,825 (GRCm39) N105Y probably damaging Het
Ros1 A G 10: 52,000,174 (GRCm39) I1138T probably benign Het
Rsbn1 C A 3: 103,822,146 (GRCm39) T127K possibly damaging Het
Rsf1 G GCCGGCGGCC 7: 97,229,116 (GRCm39) probably benign Het
Rtca T C 3: 116,301,413 (GRCm39) T45A probably benign Het
Sema6b G T 17: 56,439,500 (GRCm39) D82E probably benign Het
Serpinc1 A T 1: 160,821,179 (GRCm39) K209* probably null Het
Slc4a1 C A 11: 102,247,674 (GRCm39) R403L probably damaging Het
Smtn A G 11: 3,482,780 (GRCm39) V92A possibly damaging Het
Spag9 T C 11: 93,959,792 (GRCm39) V327A probably damaging Het
Spdl1 T C 11: 34,713,283 (GRCm39) N233S possibly damaging Het
Stimate A G 14: 30,593,463 (GRCm39) N189S probably damaging Het
Ston2 T C 12: 91,707,424 (GRCm39) D62G possibly damaging Het
Sult2a5 A G 7: 13,359,243 (GRCm39) D73G probably benign Het
Ticrr A G 7: 79,343,597 (GRCm39) E1154G probably benign Het
Tmem163 A T 1: 127,480,529 (GRCm39) M111K probably damaging Het
Tmem266 T C 9: 55,344,973 (GRCm39) V535A probably damaging Het
Tmprss7 T A 16: 45,484,555 (GRCm39) D535V probably damaging Het
Tmt1a T C 15: 100,203,215 (GRCm39) V163A probably damaging Het
Tpcn1 A C 5: 120,698,390 (GRCm39) I44S probably benign Het
Trbv12-1 T A 6: 41,090,921 (GRCm39) F98I probably damaging Het
Trhde A T 10: 114,636,697 (GRCm39) V170E probably damaging Het
Trpt1 A T 19: 6,975,578 (GRCm39) T111S probably benign Het
Ttc13 T C 8: 125,410,010 (GRCm39) T401A possibly damaging Het
Ulbp1 T C 10: 7,423,260 (GRCm39) I28V probably benign Het
Vldlr A T 19: 27,218,742 (GRCm39) D531V probably damaging Het
Vmn2r85 T A 10: 130,261,387 (GRCm39) T317S probably damaging Het
Vps33a T C 5: 123,696,705 (GRCm39) K316R probably benign Het
Vwa3b A G 1: 37,099,520 (GRCm39) N245S probably damaging Het
Zfp266 A T 9: 20,413,413 (GRCm39) C82* probably null Het
Zfp746 T C 6: 48,041,397 (GRCm39) K443R probably damaging Het
Other mutations in Acvr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02983:Acvr1b APN 15 101,100,959 (GRCm39) missense probably damaging 0.98
IGL03010:Acvr1b APN 15 101,100,959 (GRCm39) missense probably damaging 0.98
IGL03011:Acvr1b APN 15 101,100,959 (GRCm39) missense probably damaging 0.98
IGL03013:Acvr1b APN 15 101,100,959 (GRCm39) missense probably damaging 0.98
IGL03051:Acvr1b APN 15 101,100,959 (GRCm39) missense probably damaging 0.98
IGL03127:Acvr1b APN 15 101,100,959 (GRCm39) missense probably damaging 0.98
IGL03166:Acvr1b APN 15 101,100,959 (GRCm39) missense probably damaging 0.98
IGL03265:Acvr1b APN 15 101,100,959 (GRCm39) missense probably damaging 0.98
IGL02980:Acvr1b UTSW 15 101,100,959 (GRCm39) missense probably damaging 0.98
IGL02984:Acvr1b UTSW 15 101,100,959 (GRCm39) missense probably damaging 0.98
R1367:Acvr1b UTSW 15 101,091,819 (GRCm39) missense possibly damaging 0.58
R1498:Acvr1b UTSW 15 101,091,891 (GRCm39) missense probably benign
R1591:Acvr1b UTSW 15 101,091,905 (GRCm39) missense probably benign
R1757:Acvr1b UTSW 15 101,096,703 (GRCm39) missense possibly damaging 0.47
R1793:Acvr1b UTSW 15 101,091,906 (GRCm39) missense probably benign 0.01
R2223:Acvr1b UTSW 15 101,100,924 (GRCm39) missense probably benign 0.10
R2249:Acvr1b UTSW 15 101,100,975 (GRCm39) missense probably null 1.00
R4674:Acvr1b UTSW 15 101,100,939 (GRCm39) missense possibly damaging 0.94
R4676:Acvr1b UTSW 15 101,100,867 (GRCm39) missense probably damaging 1.00
R5151:Acvr1b UTSW 15 101,108,651 (GRCm39) missense probably damaging 1.00
R5223:Acvr1b UTSW 15 101,091,857 (GRCm39) missense probably damaging 1.00
R5397:Acvr1b UTSW 15 101,096,845 (GRCm39) missense probably damaging 0.99
R5574:Acvr1b UTSW 15 101,099,958 (GRCm39) missense probably benign 0.03
R5906:Acvr1b UTSW 15 101,091,772 (GRCm39) intron probably benign
R6025:Acvr1b UTSW 15 101,092,856 (GRCm39) missense probably benign 0.43
R6467:Acvr1b UTSW 15 101,092,722 (GRCm39) missense possibly damaging 0.86
R7158:Acvr1b UTSW 15 101,091,939 (GRCm39) missense probably benign
R8480:Acvr1b UTSW 15 101,108,720 (GRCm39) missense possibly damaging 0.47
X0067:Acvr1b UTSW 15 101,091,903 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CACAGTTGTAGGGGTGCTTCAC -3'
(R):5'- AGATCCTGGAGCGTCTTGTC -3'

Sequencing Primer
(F):5'- CTTCACCGAGAGAAAGGTAGTATTAG -3'
(R):5'- AGCGTCTTGTCTTTGGAGAGAC -3'
Posted On 2022-07-18