Incidental Mutation 'R9504:Steap4'
ID 717723
Institutional Source Beutler Lab
Gene Symbol Steap4
Ensembl Gene ENSMUSG00000012428
Gene Name STEAP family member 4
Synonyms Tiarp, Tnfaip9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock # R9504 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 7960457-7982213 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 7980538 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 465 (N465D)
Ref Sequence ENSEMBL: ENSMUSP00000111081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115421]
AlphaFold Q923B6
Predicted Effect probably benign
Transcript: ENSMUST00000115421
AA Change: N465D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000111081
Gene: ENSMUSG00000012428
AA Change: N465D

DomainStartEndE-ValueType
Pfam:F420_oxidored 21 107 2.3e-16 PFAM
transmembrane domain 203 225 N/A INTRINSIC
Pfam:Ferric_reduct 247 395 2.6e-14 PFAM
transmembrane domain 416 438 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the STEAP (six transmembrane epithelial antigen of prostate) family, and resides in the golgi apparatus. It functions as a metalloreductase that has the ability to reduce both Fe(3+) to Fe(2+) and Cu(2+) to Cu(1+), using NAD(+) as acceptor. Studies in mice and human suggest that this gene maybe involved in adipocyte development and metabolism, and may contribute to the normal biology of the prostate cell, as well as prostate cancer progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit adipose accumulation, oxidative stress, increased liver weight, lower metabolic rate, hypoactivity, insulin resistance, glucose intolerance, mild hyperglycemia and dyslipidemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik A G 11: 58,446,389 V86A probably benign Het
Aldh1b1 T C 4: 45,802,905 Y148H probably damaging Het
Ankib1 A G 5: 3,713,235 V498A probably benign Het
Atp6v0c A G 17: 24,164,519 V118A possibly damaging Het
Bcan G A 3: 87,993,441 P495L probably benign Het
Bnip3l G A 14: 67,008,765 P7L possibly damaging Het
Ccdc178 T C 18: 22,105,651 E303G possibly damaging Het
Ccdc47 T C 11: 106,210,329 N169S probably benign Het
Cldn23 A T 8: 35,826,316 V6E probably damaging Het
Dip2a T C 10: 76,296,355 T560A probably damaging Het
Ephb3 A G 16: 21,218,080 S352G possibly damaging Het
Far2 C A 6: 148,157,955 A256E probably damaging Het
Gga1 C T 15: 78,883,328 R89C probably damaging Het
Gm14025 C T 2: 129,039,269 A246T Het
Hbb-bh2 A G 7: 103,840,132 S71P probably damaging Het
Lama1 T A 17: 67,821,666 V3006D Het
Mrm1 G A 11: 84,819,306 R23W probably damaging Het
Nod2 A T 8: 88,665,278 I738F probably damaging Het
Olfr1260 G T 2: 89,978,153 C125F probably damaging Het
Olfr404-ps1 C T 11: 74,240,268 R235C probably benign Het
Olfr878 A G 9: 37,918,867 D70G probably damaging Het
Pkd1l1 A G 11: 8,865,631 W1877R Het
Psmd2 C T 16: 20,659,410 A515V probably benign Het
Samd9l A G 6: 3,372,621 Y1547H probably benign Het
Sgsh T C 11: 119,346,549 N413S probably benign Het
Slmap G A 14: 26,414,978 P819L probably damaging Het
Sult3a2 T C 10: 33,766,440 N289S probably benign Het
Tbx2 T A 11: 85,833,212 S36T possibly damaging Het
Tcstv1 G A 13: 119,893,731 Q122* probably null Het
Tnk2 T C 16: 32,680,143 V758A possibly damaging Het
Trrap C T 5: 144,806,094 T1425M probably damaging Het
Ttc9b A G 7: 27,654,969 K160R probably damaging Het
Zfp959 T A 17: 55,897,793 Y277N probably benign Het
Other mutations in Steap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Steap4 APN 5 7976979 missense probably damaging 1.00
IGL00827:Steap4 APN 5 7976712 missense probably damaging 1.00
IGL01481:Steap4 APN 5 7976858 missense probably damaging 0.98
IGL02378:Steap4 APN 5 7976741 missense probably benign 0.00
IGL03058:Steap4 APN 5 7975664 missense probably benign 0.00
PIT4362001:Steap4 UTSW 5 7980337 missense probably benign 0.03
R0329:Steap4 UTSW 5 7975829 missense possibly damaging 0.92
R0546:Steap4 UTSW 5 7975870 missense probably damaging 0.99
R0637:Steap4 UTSW 5 7978398 splice site probably benign
R0638:Steap4 UTSW 5 7977030 splice site probably benign
R0651:Steap4 UTSW 5 7980348 nonsense probably null
R0881:Steap4 UTSW 5 7980388 missense probably benign
R1167:Steap4 UTSW 5 7976520 missense probably benign 0.34
R1543:Steap4 UTSW 5 7975902 splice site probably benign
R1889:Steap4 UTSW 5 7975892 missense probably damaging 1.00
R3803:Steap4 UTSW 5 7976979 missense probably damaging 1.00
R3811:Steap4 UTSW 5 7977017 missense probably benign 0.18
R3885:Steap4 UTSW 5 7980494 missense probably damaging 1.00
R3887:Steap4 UTSW 5 7980494 missense probably damaging 1.00
R4051:Steap4 UTSW 5 7980404 missense probably damaging 1.00
R4208:Steap4 UTSW 5 7980404 missense probably damaging 1.00
R5016:Steap4 UTSW 5 7976699 nonsense probably null
R5302:Steap4 UTSW 5 7975547 nonsense probably null
R5951:Steap4 UTSW 5 7975769 missense probably benign 0.00
R6136:Steap4 UTSW 5 7978562 missense probably damaging 0.99
R6527:Steap4 UTSW 5 7978502 missense probably damaging 0.99
R6631:Steap4 UTSW 5 7976995 nonsense probably null
R6964:Steap4 UTSW 5 7975568 missense probably damaging 1.00
R7055:Steap4 UTSW 5 7976858 missense probably damaging 1.00
R7408:Steap4 UTSW 5 7978453 missense probably benign 0.07
R7692:Steap4 UTSW 5 7976976 missense probably benign 0.32
R8205:Steap4 UTSW 5 7976795 missense possibly damaging 0.65
R8861:Steap4 UTSW 5 7975672 missense probably benign 0.00
R9287:Steap4 UTSW 5 7976683 missense probably benign 0.05
R9423:Steap4 UTSW 5 7976720 missense probably damaging 0.99
R9531:Steap4 UTSW 5 7978424 missense probably benign 0.20
R9566:Steap4 UTSW 5 7975646 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- ATCTGACCCTGGTCTTGTGC -3'
(R):5'- TATTCTGGTCTTTCAAAGTGAGGC -3'

Sequencing Primer
(F):5'- ACAGCCCACACTTTGGTG -3'
(R):5'- GAGGCAACACTTCCTACTGTGATG -3'
Posted On 2022-07-18