Incidental Mutation 'R9505:Gm14025'
ID 717757
Institutional Source Beutler Lab
Gene Symbol Gm14025
Ensembl Gene ENSMUSG00000079051
Gene Name predicted gene 14025
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R9505 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 129025073-129048172 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 129036918 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1029 (D1029E)
Ref Sequence ENSEMBL: ENSMUSP00000123404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000145798]
AlphaFold A2AP89
Predicted Effect unknown
Transcript: ENSMUST00000145798
AA Change: D1029E
SMART Domains Protein: ENSMUSP00000123404
Gene: ENSMUSG00000079051
AA Change: D1029E

DomainStartEndE-ValueType
Pfam:Vinculin 14 248 5.8e-18 PFAM
Pfam:Vinculin 281 619 2.1e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,329,354 M1V probably null Het
4931406P16Rik A T 7: 34,284,946 L84Q probably damaging Het
9530053A07Rik A T 7: 28,142,484 K615* probably null Het
Ablim1 A G 19: 57,197,350 probably benign Het
Adamts17 A C 7: 67,124,935 N961T probably benign Het
Adamts3 G A 5: 89,707,892 T373I probably damaging Het
Bcan G A 3: 87,993,441 P495L probably benign Het
Bicd1 A C 6: 149,484,024 E85A probably benign Het
Brca1 G T 11: 101,512,766 H1437N probably benign Het
Camk2n1 T C 4: 138,455,256 I24T possibly damaging Het
Ces2f T A 8: 104,950,037 M121K probably benign Het
CN725425 T A 15: 91,240,664 Y136N possibly damaging Het
Ctla2a T A 13: 60,936,528 M2L unknown Het
Cyp3a57 A T 5: 145,349,329 Y25F probably benign Het
Dicer1 C T 12: 104,731,038 V87M possibly damaging Het
Dnah3 A T 7: 120,045,689 I1123N probably damaging Het
Fam212a T A 9: 107,984,893 K75* probably null Het
Fkbp10 G T 11: 100,416,000 E73* probably null Het
Flnb C A 14: 7,904,665 H1023N probably benign Het
Gapvd1 T A 2: 34,723,014 Q312H Het
Htr1d A T 4: 136,443,578 I373F probably benign Het
Inhba G A 13: 16,026,771 R306H probably damaging Het
Iqcg A T 16: 33,040,877 D156E probably benign Het
Ireb2 C A 9: 54,906,637 T798K probably damaging Het
Klk8 G A 7: 43,802,181 A199T probably damaging Het
Lgi2 T C 5: 52,554,433 T182A probably benign Het
Ltbp2 C A 12: 84,853,864 R228L probably damaging Het
Lyrm1 A G 7: 119,909,867 K22E possibly damaging Het
Mybbp1a A G 11: 72,449,071 D967G probably benign Het
Nr6a1 C T 2: 38,740,473 R259Q probably benign Het
Olfr1509 A G 14: 52,450,472 N20D probably benign Het
Olfr611 T C 7: 103,518,239 I48M probably benign Het
Olfr640 C A 7: 104,021,491 V276F probably damaging Het
Pak7 A T 2: 136,116,892 I92N probably damaging Het
Pcdhb5 T A 18: 37,321,611 I348K possibly damaging Het
Phf2 C T 13: 48,803,658 A1078T probably damaging Het
Rnf103 T C 6: 71,510,065 V560A probably benign Het
Slc27a4 A G 2: 29,811,596 I409V probably benign Het
Spata18 T A 5: 73,651,674 probably null Het
Spon1 A G 7: 114,033,076 T545A probably damaging Het
Stab1 A G 14: 31,155,765 S772P probably damaging Het
Stox2 A T 8: 47,192,269 S719T probably benign Het
Syne1 A G 10: 5,030,394 V864A probably benign Het
Syngap1 A G 17: 26,961,605 S836G probably benign Het
Tiparp G T 3: 65,532,156 E298* probably null Het
Tmem52 A G 4: 155,470,158 T114A probably damaging Het
Trim36 C A 18: 46,196,214 C53F probably damaging Het
Ttn C A 2: 76,885,124 probably null Het
Ttn T C 2: 76,890,467 K6871R unknown Het
Ube2d1 T C 10: 71,262,264 probably null Het
Unc13c T C 9: 73,931,542 T676A probably benign Het
Vps13a A T 19: 16,742,544 Y417N possibly damaging Het
Zfp729a C T 13: 67,619,554 C852Y probably damaging Het
Other mutations in Gm14025
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Gm14025 APN 2 129038702 missense probably benign 0.01
IGL02423:Gm14025 APN 2 129048048 missense probably benign 0.03
IGL02730:Gm14025 APN 2 129038726 missense possibly damaging 0.57
PIT4677001:Gm14025 UTSW 2 129038716 missense
R0019:Gm14025 UTSW 2 129039026 missense probably benign 0.26
R3946:Gm14025 UTSW 2 129039601 missense probably damaging 1.00
R4666:Gm14025 UTSW 2 129038230 missense probably benign 0.02
R4819:Gm14025 UTSW 2 129040801 missense probably damaging 0.96
R5634:Gm14025 UTSW 2 129039486 missense probably benign
R6019:Gm14025 UTSW 2 129037690 missense probably benign
R6241:Gm14025 UTSW 2 129037381 missense possibly damaging 0.87
R6285:Gm14025 UTSW 2 129037799 missense possibly damaging 0.82
R6377:Gm14025 UTSW 2 129036811 missense unknown
R6464:Gm14025 UTSW 2 129039545 missense possibly damaging 0.85
R6724:Gm14025 UTSW 2 129038056 missense probably benign 0.23
R7050:Gm14025 UTSW 2 129027971 splice site probably null
R7130:Gm14025 UTSW 2 129039181 missense
R7199:Gm14025 UTSW 2 129038318 missense
R7324:Gm14025 UTSW 2 129037852 missense unknown
R7355:Gm14025 UTSW 2 129037229 missense unknown
R7407:Gm14025 UTSW 2 129038809 missense
R7634:Gm14025 UTSW 2 129038272 missense
R7688:Gm14025 UTSW 2 129039044 nonsense probably null
R7889:Gm14025 UTSW 2 129036994 missense unknown
R7894:Gm14025 UTSW 2 129037129 missense unknown
R8242:Gm14025 UTSW 2 129039393 nonsense probably null
R8373:Gm14025 UTSW 2 129038171 missense
R8927:Gm14025 UTSW 2 129040869 missense
R8928:Gm14025 UTSW 2 129040869 missense
R9231:Gm14025 UTSW 2 129037420 missense unknown
R9504:Gm14025 UTSW 2 129039269 missense
R9608:Gm14025 UTSW 2 129036630 nonsense probably null
R9682:Gm14025 UTSW 2 129033609 missense unknown
R9760:Gm14025 UTSW 2 129038579 missense
RF002:Gm14025 UTSW 2 129038794 missense
X0066:Gm14025 UTSW 2 129039067 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TGAAGCCAGTCCAGCGTATG -3'
(R):5'- TGCAGGGAAGTTCATGTACTCAC -3'

Sequencing Primer
(F):5'- GTCCAGCGTATGCAAACTCTG -3'
(R):5'- TCACAGATGCCTTGCTAGAG -3'
Posted On 2022-07-18