Incidental Mutation 'R9505:Pak7'
ID 717758
Institutional Source Beutler Lab
Gene Symbol Pak7
Ensembl Gene ENSMUSG00000039913
Gene Name p21 (RAC1) activated kinase 7
Synonyms 2900083L08Rik, Pak5
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9505 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 136081104-136387967 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 136116892 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 92 (I92N)
Ref Sequence ENSEMBL: ENSMUSP00000047285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035264] [ENSMUST00000077200]
AlphaFold Q8C015
Predicted Effect probably damaging
Transcript: ENSMUST00000035264
AA Change: I92N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047285
Gene: ENSMUSG00000039913
AA Change: I92N

DomainStartEndE-ValueType
PBD 11 46 5.3e-13 SMART
low complexity region 394 415 N/A INTRINSIC
S_TKc 449 700 1.39e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077200
AA Change: I92N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076440
Gene: ENSMUSG00000039913
AA Change: I92N

DomainStartEndE-ValueType
PBD 11 46 5.3e-13 SMART
low complexity region 394 415 N/A INTRINSIC
S_TKc 449 700 1.39e-90 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PAK family of Ser/Thr protein kinases. PAK family members are known to be effectors of Rac/Cdc42 GTPases, which have been implicated in the regulation of cytoskeletal dynamics, proliferation, and cell survival signaling. This kinase contains a CDC42/Rac1 interactive binding (CRIB) motif, and has been shown to bind CDC42 in the presence of GTP. This kinase is predominantly expressed in brain. It is capable of promoting neurite outgrowth, and thus may play a role in neurite development. This kinase is associated with microtubule networks and induces microtubule stabilization. The subcellular localization of this kinase is tightly regulated during cell cycle progression. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit impaired active avoidance learning but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,329,354 M1V probably null Het
4931406P16Rik A T 7: 34,284,946 L84Q probably damaging Het
9530053A07Rik A T 7: 28,142,484 K615* probably null Het
Ablim1 A G 19: 57,197,350 probably benign Het
Adamts17 A C 7: 67,124,935 N961T probably benign Het
Adamts3 G A 5: 89,707,892 T373I probably damaging Het
Bcan G A 3: 87,993,441 P495L probably benign Het
Bicd1 A C 6: 149,484,024 E85A probably benign Het
Brca1 G T 11: 101,512,766 H1437N probably benign Het
Camk2n1 T C 4: 138,455,256 I24T possibly damaging Het
Ces2f T A 8: 104,950,037 M121K probably benign Het
CN725425 T A 15: 91,240,664 Y136N possibly damaging Het
Ctla2a T A 13: 60,936,528 M2L unknown Het
Cyp3a57 A T 5: 145,349,329 Y25F probably benign Het
Dicer1 C T 12: 104,731,038 V87M possibly damaging Het
Dnah3 A T 7: 120,045,689 I1123N probably damaging Het
Fam212a T A 9: 107,984,893 K75* probably null Het
Fkbp10 G T 11: 100,416,000 E73* probably null Het
Flnb C A 14: 7,904,665 H1023N probably benign Het
Gapvd1 T A 2: 34,723,014 Q312H Het
Gm14025 A T 2: 129,036,918 D1029E unknown Het
Htr1d A T 4: 136,443,578 I373F probably benign Het
Inhba G A 13: 16,026,771 R306H probably damaging Het
Iqcg A T 16: 33,040,877 D156E probably benign Het
Ireb2 C A 9: 54,906,637 T798K probably damaging Het
Klk8 G A 7: 43,802,181 A199T probably damaging Het
Lgi2 T C 5: 52,554,433 T182A probably benign Het
Ltbp2 C A 12: 84,853,864 R228L probably damaging Het
Lyrm1 A G 7: 119,909,867 K22E possibly damaging Het
Mybbp1a A G 11: 72,449,071 D967G probably benign Het
Nr6a1 C T 2: 38,740,473 R259Q probably benign Het
Olfr1509 A G 14: 52,450,472 N20D probably benign Het
Olfr611 T C 7: 103,518,239 I48M probably benign Het
Olfr640 C A 7: 104,021,491 V276F probably damaging Het
Pcdhb5 T A 18: 37,321,611 I348K possibly damaging Het
Phf2 C T 13: 48,803,658 A1078T probably damaging Het
Rnf103 T C 6: 71,510,065 V560A probably benign Het
Slc27a4 A G 2: 29,811,596 I409V probably benign Het
Spata18 T A 5: 73,651,674 probably null Het
Spon1 A G 7: 114,033,076 T545A probably damaging Het
Stab1 A G 14: 31,155,765 S772P probably damaging Het
Stox2 A T 8: 47,192,269 S719T probably benign Het
Syne1 A G 10: 5,030,394 V864A probably benign Het
Syngap1 A G 17: 26,961,605 S836G probably benign Het
Tiparp G T 3: 65,532,156 E298* probably null Het
Tmem52 A G 4: 155,470,158 T114A probably damaging Het
Trim36 C A 18: 46,196,214 C53F probably damaging Het
Ttn C A 2: 76,885,124 probably null Het
Ttn T C 2: 76,890,467 K6871R unknown Het
Ube2d1 T C 10: 71,262,264 probably null Het
Unc13c T C 9: 73,931,542 T676A probably benign Het
Vps13a A T 19: 16,742,544 Y417N possibly damaging Het
Zfp729a C T 13: 67,619,554 C852Y probably damaging Het
Other mutations in Pak7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01671:Pak7 APN 2 136116373 missense possibly damaging 0.89
IGL01743:Pak7 APN 2 136087413 missense probably damaging 1.00
IGL02601:Pak7 APN 2 136116935 nonsense probably null
IGL03172:Pak7 APN 2 136098390 nonsense probably null
currency UTSW 2 136100939 missense probably benign 0.15
Depreciation UTSW 2 136097534 missense probably damaging 1.00
PIT4498001:Pak7 UTSW 2 136083291 missense probably damaging 1.00
R0025:Pak7 UTSW 2 136100784 missense possibly damaging 0.68
R0025:Pak7 UTSW 2 136100784 missense possibly damaging 0.68
R0400:Pak7 UTSW 2 136097579 missense possibly damaging 0.95
R0441:Pak7 UTSW 2 136116629 missense probably benign
R1653:Pak7 UTSW 2 136116887 missense probably damaging 1.00
R1662:Pak7 UTSW 2 136116760 missense probably damaging 0.96
R1855:Pak7 UTSW 2 136087509 missense probably benign 0.00
R1872:Pak7 UTSW 2 136085588 missense possibly damaging 0.93
R2001:Pak7 UTSW 2 136116637 missense probably benign 0.00
R2002:Pak7 UTSW 2 136116637 missense probably benign 0.00
R2157:Pak7 UTSW 2 136100957 missense probably damaging 0.96
R2160:Pak7 UTSW 2 136098382 missense probably benign 0.01
R2217:Pak7 UTSW 2 136116203 missense probably damaging 1.00
R3797:Pak7 UTSW 2 136100826 missense probably benign 0.06
R4711:Pak7 UTSW 2 136087517 missense probably damaging 1.00
R4904:Pak7 UTSW 2 136083347 missense probably benign 0.02
R5090:Pak7 UTSW 2 136087418 missense probably damaging 1.00
R5120:Pak7 UTSW 2 136083229 missense probably damaging 0.97
R5669:Pak7 UTSW 2 136116284 missense probably damaging 1.00
R5954:Pak7 UTSW 2 136116463 missense probably benign 0.01
R6127:Pak7 UTSW 2 136087406 missense probably damaging 0.99
R6250:Pak7 UTSW 2 136174269 start gained probably benign
R6471:Pak7 UTSW 2 136116190 missense probably benign 0.00
R6797:Pak7 UTSW 2 136097534 missense probably damaging 1.00
R6809:Pak7 UTSW 2 136097581 missense possibly damaging 0.83
R6945:Pak7 UTSW 2 136100939 missense probably benign 0.15
R7254:Pak7 UTSW 2 136116764 missense possibly damaging 0.50
R7265:Pak7 UTSW 2 136101185 missense probably benign 0.03
R7335:Pak7 UTSW 2 136098299 missense probably damaging 1.00
R7511:Pak7 UTSW 2 136083324 missense possibly damaging 0.87
R7573:Pak7 UTSW 2 136116305 missense probably damaging 1.00
R7593:Pak7 UTSW 2 136100964 missense probably benign 0.40
R7908:Pak7 UTSW 2 136116559 missense probably benign 0.14
R8304:Pak7 UTSW 2 136098283 missense probably benign 0.11
R9091:Pak7 UTSW 2 136116768 missense probably damaging 0.98
R9177:Pak7 UTSW 2 136101206 missense probably benign 0.00
R9270:Pak7 UTSW 2 136116768 missense probably damaging 0.98
Z1176:Pak7 UTSW 2 136083246 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCCAGGTCATCTCCATAGAG -3'
(R):5'- TTTTCCAGTGAAGTTAGGCAAC -3'

Sequencing Primer
(F):5'- GACTCCTGTCTCTGTACTTTTCAG -3'
(R):5'- AAATGTTTCTCTCATGTTTCCTTCTG -3'
Posted On 2022-07-18