Incidental Mutation 'R9505:Adamts3'
ID 717766
Institutional Source Beutler Lab
Gene Symbol Adamts3
Ensembl Gene ENSMUSG00000043635
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3
Synonyms 6330442E02Rik, 1100001H14Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9505 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 89677087-89883334 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 89707892 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 373 (T373I)
Ref Sequence ENSEMBL: ENSMUSP00000132219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]
AlphaFold E9Q287
Predicted Effect probably damaging
Transcript: ENSMUST00000061427
AA Change: T373I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: T373I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 201 5.1e-40 PFAM
Pfam:Reprolysin_5 254 439 5.4e-15 PFAM
Pfam:Reprolysin_4 256 454 1.9e-10 PFAM
Pfam:Reprolysin 257 460 3.6e-22 PFAM
Pfam:Reprolysin_2 274 451 7.7e-13 PFAM
Pfam:Reprolysin_3 278 409 1.5e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 827 3e-34 PFAM
TSP1 848 905 4.35e-2 SMART
TSP1 908 967 4.95e-2 SMART
TSP1 969 1016 6.58e-5 SMART
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1157 1177 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163159
AA Change: T373I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: T373I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 201 1.5e-40 PFAM
Pfam:Reprolysin_5 254 439 2.2e-15 PFAM
Pfam:Reprolysin_4 256 454 7.7e-11 PFAM
Pfam:Reprolysin 257 460 3.7e-21 PFAM
Pfam:Reprolysin_2 274 451 4.3e-14 PFAM
Pfam:Reprolysin_3 278 409 1.3e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 828 3.6e-28 PFAM
TSP1 849 906 4.35e-2 SMART
TSP1 909 968 4.95e-2 SMART
TSP1 970 1017 6.58e-5 SMART
low complexity region 1115 1129 N/A INTRINSIC
low complexity region 1158 1178 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,329,354 M1V probably null Het
4931406P16Rik A T 7: 34,284,946 L84Q probably damaging Het
9530053A07Rik A T 7: 28,142,484 K615* probably null Het
Ablim1 A G 19: 57,197,350 probably benign Het
Adamts17 A C 7: 67,124,935 N961T probably benign Het
Bcan G A 3: 87,993,441 P495L probably benign Het
Bicd1 A C 6: 149,484,024 E85A probably benign Het
Brca1 G T 11: 101,512,766 H1437N probably benign Het
Camk2n1 T C 4: 138,455,256 I24T possibly damaging Het
Ces2f T A 8: 104,950,037 M121K probably benign Het
CN725425 T A 15: 91,240,664 Y136N possibly damaging Het
Ctla2a T A 13: 60,936,528 M2L unknown Het
Cyp3a57 A T 5: 145,349,329 Y25F probably benign Het
Dicer1 C T 12: 104,731,038 V87M possibly damaging Het
Dnah3 A T 7: 120,045,689 I1123N probably damaging Het
Fam212a T A 9: 107,984,893 K75* probably null Het
Fkbp10 G T 11: 100,416,000 E73* probably null Het
Flnb C A 14: 7,904,665 H1023N probably benign Het
Gapvd1 T A 2: 34,723,014 Q312H Het
Gm14025 A T 2: 129,036,918 D1029E unknown Het
Htr1d A T 4: 136,443,578 I373F probably benign Het
Inhba G A 13: 16,026,771 R306H probably damaging Het
Iqcg A T 16: 33,040,877 D156E probably benign Het
Ireb2 C A 9: 54,906,637 T798K probably damaging Het
Klk8 G A 7: 43,802,181 A199T probably damaging Het
Lgi2 T C 5: 52,554,433 T182A probably benign Het
Ltbp2 C A 12: 84,853,864 R228L probably damaging Het
Lyrm1 A G 7: 119,909,867 K22E possibly damaging Het
Mybbp1a A G 11: 72,449,071 D967G probably benign Het
Nr6a1 C T 2: 38,740,473 R259Q probably benign Het
Olfr1509 A G 14: 52,450,472 N20D probably benign Het
Olfr611 T C 7: 103,518,239 I48M probably benign Het
Olfr640 C A 7: 104,021,491 V276F probably damaging Het
Pak7 A T 2: 136,116,892 I92N probably damaging Het
Pcdhb5 T A 18: 37,321,611 I348K possibly damaging Het
Phf2 C T 13: 48,803,658 A1078T probably damaging Het
Rnf103 T C 6: 71,510,065 V560A probably benign Het
Slc27a4 A G 2: 29,811,596 I409V probably benign Het
Spata18 T A 5: 73,651,674 probably null Het
Spon1 A G 7: 114,033,076 T545A probably damaging Het
Stab1 A G 14: 31,155,765 S772P probably damaging Het
Stox2 A T 8: 47,192,269 S719T probably benign Het
Syne1 A G 10: 5,030,394 V864A probably benign Het
Syngap1 A G 17: 26,961,605 S836G probably benign Het
Tiparp G T 3: 65,532,156 E298* probably null Het
Tmem52 A G 4: 155,470,158 T114A probably damaging Het
Trim36 C A 18: 46,196,214 C53F probably damaging Het
Ttn C A 2: 76,885,124 probably null Het
Ttn T C 2: 76,890,467 K6871R unknown Het
Ube2d1 T C 10: 71,262,264 probably null Het
Unc13c T C 9: 73,931,542 T676A probably benign Het
Vps13a A T 19: 16,742,544 Y417N possibly damaging Het
Zfp729a C T 13: 67,619,554 C852Y probably damaging Het
Other mutations in Adamts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Adamts3 APN 5 89861325 missense probably damaging 1.00
IGL00340:Adamts3 APN 5 89701666 missense probably damaging 1.00
IGL00923:Adamts3 APN 5 89684376 missense probably benign 0.06
IGL01420:Adamts3 APN 5 89703057 missense possibly damaging 0.57
IGL01522:Adamts3 APN 5 89702943 missense probably benign 0.14
IGL01676:Adamts3 APN 5 89677754 missense probably benign 0.00
IGL01676:Adamts3 APN 5 89881543 missense possibly damaging 0.54
IGL01678:Adamts3 APN 5 89707856 missense probably damaging 1.00
IGL01936:Adamts3 APN 5 89861423 missense probably benign 0.00
IGL01956:Adamts3 APN 5 89677911 missense probably damaging 0.99
IGL02342:Adamts3 APN 5 89691473 splice site probably null
IGL02415:Adamts3 APN 5 89706647 splice site probably null
IGL03261:Adamts3 APN 5 89882897 utr 5 prime probably benign
IGL03301:Adamts3 APN 5 89707404 missense probably damaging 1.00
R0041:Adamts3 UTSW 5 89684467 missense probably benign
R0079:Adamts3 UTSW 5 89693053 missense probably benign 0.00
R0096:Adamts3 UTSW 5 89701717 nonsense probably null
R0096:Adamts3 UTSW 5 89701717 nonsense probably null
R0477:Adamts3 UTSW 5 89684507 missense probably benign
R0605:Adamts3 UTSW 5 89861475 missense possibly damaging 0.96
R1036:Adamts3 UTSW 5 89696093 splice site probably benign
R1462:Adamts3 UTSW 5 89861349 missense probably benign 0.17
R1462:Adamts3 UTSW 5 89861349 missense probably benign 0.17
R1621:Adamts3 UTSW 5 89721701 missense probably damaging 1.00
R1799:Adamts3 UTSW 5 89775421 missense probably benign 0.00
R2163:Adamts3 UTSW 5 89708718 missense probably damaging 0.99
R2412:Adamts3 UTSW 5 89701771 missense probably damaging 0.99
R2420:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2421:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2422:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2921:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R2922:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R2923:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R3402:Adamts3 UTSW 5 89701733 missense probably benign 0.04
R3431:Adamts3 UTSW 5 89707453 splice site probably benign
R3432:Adamts3 UTSW 5 89707453 splice site probably benign
R3813:Adamts3 UTSW 5 89677926 missense possibly damaging 0.67
R3816:Adamts3 UTSW 5 89705264 missense probably damaging 0.99
R3905:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3906:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3907:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3908:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R4557:Adamts3 UTSW 5 89700487 missense probably benign 0.03
R4684:Adamts3 UTSW 5 89703007 missense probably damaging 0.98
R4844:Adamts3 UTSW 5 89677816 missense probably damaging 0.99
R4925:Adamts3 UTSW 5 89684323 missense probably benign 0.01
R5097:Adamts3 UTSW 5 89693050 missense probably damaging 0.97
R5100:Adamts3 UTSW 5 89708643 missense probably damaging 1.00
R5237:Adamts3 UTSW 5 89775377 missense probably benign
R5265:Adamts3 UTSW 5 89861552 missense possibly damaging 0.91
R5322:Adamts3 UTSW 5 89707300 splice site probably null
R5413:Adamts3 UTSW 5 89708767 missense probably damaging 1.00
R5459:Adamts3 UTSW 5 89691473 splice site probably null
R5738:Adamts3 UTSW 5 89708668 missense probably damaging 1.00
R5979:Adamts3 UTSW 5 89861669 missense probably damaging 0.96
R5992:Adamts3 UTSW 5 89691335 missense probably damaging 1.00
R6364:Adamts3 UTSW 5 89721814 missense possibly damaging 0.92
R6572:Adamts3 UTSW 5 89861609 missense possibly damaging 0.87
R7098:Adamts3 UTSW 5 89861495 missense probably damaging 1.00
R7172:Adamts3 UTSW 5 89883001 start gained probably benign
R7263:Adamts3 UTSW 5 89677742 missense probably benign 0.03
R7401:Adamts3 UTSW 5 89707450 critical splice acceptor site probably null
R7599:Adamts3 UTSW 5 89861397 missense probably benign 0.00
R7829:Adamts3 UTSW 5 89861490 missense probably damaging 1.00
R7835:Adamts3 UTSW 5 89700440 missense possibly damaging 0.70
R7892:Adamts3 UTSW 5 89861429 missense probably benign 0.10
R8021:Adamts3 UTSW 5 89683184 missense possibly damaging 0.47
R8289:Adamts3 UTSW 5 89775423 missense possibly damaging 0.89
R8350:Adamts3 UTSW 5 89702956 missense probably damaging 1.00
R8468:Adamts3 UTSW 5 89694768 missense probably benign 0.19
R8827:Adamts3 UTSW 5 89691465 missense probably benign 0.03
R8864:Adamts3 UTSW 5 89707122 intron probably benign
R8906:Adamts3 UTSW 5 89677716 missense probably damaging 0.98
R9000:Adamts3 UTSW 5 89706711 missense probably benign 0.17
R9005:Adamts3 UTSW 5 89677834 missense probably benign 0.08
R9378:Adamts3 UTSW 5 89700410 nonsense probably null
R9516:Adamts3 UTSW 5 89686891 missense probably damaging 1.00
X0064:Adamts3 UTSW 5 89703042 missense possibly damaging 0.75
Z1088:Adamts3 UTSW 5 89684449 missense probably damaging 0.99
Z1176:Adamts3 UTSW 5 89775351 missense not run
Z1177:Adamts3 UTSW 5 89707864 nonsense probably null
Z1177:Adamts3 UTSW 5 89775351 missense not run
Predicted Primers PCR Primer
(F):5'- GACCCTTCCCTGTGTTAAGC -3'
(R):5'- AAGAGAACATGGCTTGCTGG -3'

Sequencing Primer
(F):5'- GTTAAGCTCCTCACACTTGGCAAAG -3'
(R):5'- TGGTAACAGAGAAGTAATATTGCCCC -3'
Posted On 2022-07-18