Incidental Mutation 'R9505:Ireb2'
ID 717782
Institutional Source Beutler Lab
Gene Symbol Ireb2
Ensembl Gene ENSMUSG00000032293
Gene Name iron responsive element binding protein 2
Synonyms D9Ertd85e, Irp2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9505 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 54863789-54912530 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 54906637 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 798 (T798K)
Ref Sequence ENSEMBL: ENSMUSP00000034843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034843]
AlphaFold Q811J3
Predicted Effect probably damaging
Transcript: ENSMUST00000034843
AA Change: T798K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034843
Gene: ENSMUSG00000032293
AA Change: T798K

DomainStartEndE-ValueType
Pfam:Aconitase 59 155 6.5e-16 PFAM
Pfam:Aconitase 186 639 2e-129 PFAM
Pfam:Aconitase_C 767 896 1.5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214023
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene results in microcytic anemia, altered body iron homeostasis, and variable behavioral and neurological phenotypes that may include pathological signs of neurodegeneration or brain iron accumulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,329,354 M1V probably null Het
4931406P16Rik A T 7: 34,284,946 L84Q probably damaging Het
9530053A07Rik A T 7: 28,142,484 K615* probably null Het
Ablim1 A G 19: 57,197,350 probably benign Het
Adamts17 A C 7: 67,124,935 N961T probably benign Het
Adamts3 G A 5: 89,707,892 T373I probably damaging Het
Bcan G A 3: 87,993,441 P495L probably benign Het
Bicd1 A C 6: 149,484,024 E85A probably benign Het
Brca1 G T 11: 101,512,766 H1437N probably benign Het
Camk2n1 T C 4: 138,455,256 I24T possibly damaging Het
Ces2f T A 8: 104,950,037 M121K probably benign Het
CN725425 T A 15: 91,240,664 Y136N possibly damaging Het
Ctla2a T A 13: 60,936,528 M2L unknown Het
Cyp3a57 A T 5: 145,349,329 Y25F probably benign Het
Dicer1 C T 12: 104,731,038 V87M possibly damaging Het
Dnah3 A T 7: 120,045,689 I1123N probably damaging Het
Fam212a T A 9: 107,984,893 K75* probably null Het
Fkbp10 G T 11: 100,416,000 E73* probably null Het
Flnb C A 14: 7,904,665 H1023N probably benign Het
Gapvd1 T A 2: 34,723,014 Q312H Het
Gm14025 A T 2: 129,036,918 D1029E unknown Het
Htr1d A T 4: 136,443,578 I373F probably benign Het
Inhba G A 13: 16,026,771 R306H probably damaging Het
Iqcg A T 16: 33,040,877 D156E probably benign Het
Klk8 G A 7: 43,802,181 A199T probably damaging Het
Lgi2 T C 5: 52,554,433 T182A probably benign Het
Ltbp2 C A 12: 84,853,864 R228L probably damaging Het
Lyrm1 A G 7: 119,909,867 K22E possibly damaging Het
Mybbp1a A G 11: 72,449,071 D967G probably benign Het
Nr6a1 C T 2: 38,740,473 R259Q probably benign Het
Olfr1509 A G 14: 52,450,472 N20D probably benign Het
Olfr611 T C 7: 103,518,239 I48M probably benign Het
Olfr640 C A 7: 104,021,491 V276F probably damaging Het
Pak7 A T 2: 136,116,892 I92N probably damaging Het
Pcdhb5 T A 18: 37,321,611 I348K possibly damaging Het
Phf2 C T 13: 48,803,658 A1078T probably damaging Het
Rnf103 T C 6: 71,510,065 V560A probably benign Het
Slc27a4 A G 2: 29,811,596 I409V probably benign Het
Spata18 T A 5: 73,651,674 probably null Het
Spon1 A G 7: 114,033,076 T545A probably damaging Het
Stab1 A G 14: 31,155,765 S772P probably damaging Het
Stox2 A T 8: 47,192,269 S719T probably benign Het
Syne1 A G 10: 5,030,394 V864A probably benign Het
Syngap1 A G 17: 26,961,605 S836G probably benign Het
Tiparp G T 3: 65,532,156 E298* probably null Het
Tmem52 A G 4: 155,470,158 T114A probably damaging Het
Trim36 C A 18: 46,196,214 C53F probably damaging Het
Ttn C A 2: 76,885,124 probably null Het
Ttn T C 2: 76,890,467 K6871R unknown Het
Ube2d1 T C 10: 71,262,264 probably null Het
Unc13c T C 9: 73,931,542 T676A probably benign Het
Vps13a A T 19: 16,742,544 Y417N possibly damaging Het
Zfp729a C T 13: 67,619,554 C852Y probably damaging Het
Other mutations in Ireb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Ireb2 APN 9 54899482 splice site probably benign
IGL01576:Ireb2 APN 9 54892510 missense probably damaging 1.00
IGL01844:Ireb2 APN 9 54865357 missense probably benign 0.01
bonkers UTSW 9 54896495 missense probably benign 0.00
homicidal UTSW 9 54886567 nonsense probably null
remorseless UTSW 9 54882333 missense possibly damaging 0.83
tony_stark UTSW 9 54903961 missense probably damaging 1.00
R0143:Ireb2 UTSW 9 54885909 missense probably benign 0.06
R0279:Ireb2 UTSW 9 54886593 missense probably benign
R0400:Ireb2 UTSW 9 54896498 missense probably benign
R0565:Ireb2 UTSW 9 54899983 missense probably damaging 1.00
R0686:Ireb2 UTSW 9 54904176 missense probably benign 0.44
R0706:Ireb2 UTSW 9 54892486 missense probably benign
R0894:Ireb2 UTSW 9 54896577 missense probably damaging 1.00
R1101:Ireb2 UTSW 9 54909702 missense probably benign 0.35
R1680:Ireb2 UTSW 9 54881518 missense probably damaging 1.00
R2074:Ireb2 UTSW 9 54881449 missense probably benign
R2080:Ireb2 UTSW 9 54896552 missense possibly damaging 0.85
R2891:Ireb2 UTSW 9 54899990 missense probably benign 0.01
R3153:Ireb2 UTSW 9 54885946 critical splice donor site probably null
R3154:Ireb2 UTSW 9 54885946 critical splice donor site probably null
R3844:Ireb2 UTSW 9 54892505 missense probably damaging 0.99
R4128:Ireb2 UTSW 9 54881432 missense probably benign 0.32
R4803:Ireb2 UTSW 9 54906814 missense probably benign 0.01
R5097:Ireb2 UTSW 9 54895384 missense probably benign 0.04
R5159:Ireb2 UTSW 9 54892547 missense probably benign
R5227:Ireb2 UTSW 9 54896601 critical splice donor site probably null
R5767:Ireb2 UTSW 9 54900516 missense probably benign
R6005:Ireb2 UTSW 9 54908805 missense probably damaging 1.00
R6127:Ireb2 UTSW 9 54882368 missense probably benign
R6155:Ireb2 UTSW 9 54886527 missense probably damaging 1.00
R6170:Ireb2 UTSW 9 54887372 missense probably benign 0.00
R6341:Ireb2 UTSW 9 54908780 missense probably damaging 0.99
R6707:Ireb2 UTSW 9 54903961 missense probably damaging 1.00
R6973:Ireb2 UTSW 9 54882387 missense probably benign 0.00
R7108:Ireb2 UTSW 9 54906641 missense probably damaging 1.00
R7126:Ireb2 UTSW 9 54886567 nonsense probably null
R7314:Ireb2 UTSW 9 54892510 missense probably damaging 1.00
R7396:Ireb2 UTSW 9 54882333 missense possibly damaging 0.83
R7472:Ireb2 UTSW 9 54884054 missense probably benign 0.11
R7590:Ireb2 UTSW 9 54896495 missense probably benign 0.00
R7842:Ireb2 UTSW 9 54909686 missense probably benign 0.01
R7894:Ireb2 UTSW 9 54882336 missense probably damaging 1.00
R8443:Ireb2 UTSW 9 54903981 missense possibly damaging 0.94
R8902:Ireb2 UTSW 9 54892502 missense probably benign 0.03
R9323:Ireb2 UTSW 9 54904239 critical splice donor site probably null
RF006:Ireb2 UTSW 9 54881484 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CGATAAACGCATGTATAGTCGTTG -3'
(R):5'- ACATCGAGCTGTACATTAAACAGAC -3'

Sequencing Primer
(F):5'- GCTTGAGATCAGCTAAAGTTTCAGG -3'
(R):5'- GCTGTACATTAAACAGACAGAAAAC -3'
Posted On 2022-07-18