Incidental Mutation 'R9505:Brca1'
ID 717789
Institutional Source Beutler Lab
Gene Symbol Brca1
Ensembl Gene ENSMUSG00000017146
Gene Name breast cancer 1, early onset
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9505 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 101488764-101551955 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 101512766 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 1437 (H1437N)
Ref Sequence ENSEMBL: ENSMUSP00000017290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017290]
AlphaFold P48754
Predicted Effect probably benign
Transcript: ENSMUST00000017290
AA Change: H1437N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: H1437N

DomainStartEndE-ValueType
RING 24 64 1.82e-7 SMART
Pfam:BRCT_assoc 342 503 2.6e-69 PFAM
low complexity region 1173 1185 N/A INTRINSIC
Blast:BRCT 1343 1406 2e-16 BLAST
low complexity region 1555 1575 N/A INTRINSIC
BRCT 1587 1669 3.87e-11 SMART
BRCT 1700 1787 3.42e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,329,354 M1V probably null Het
4931406P16Rik A T 7: 34,284,946 L84Q probably damaging Het
9530053A07Rik A T 7: 28,142,484 K615* probably null Het
Ablim1 A G 19: 57,197,350 probably benign Het
Adamts17 A C 7: 67,124,935 N961T probably benign Het
Adamts3 G A 5: 89,707,892 T373I probably damaging Het
Bcan G A 3: 87,993,441 P495L probably benign Het
Bicd1 A C 6: 149,484,024 E85A probably benign Het
Camk2n1 T C 4: 138,455,256 I24T possibly damaging Het
Ces2f T A 8: 104,950,037 M121K probably benign Het
CN725425 T A 15: 91,240,664 Y136N possibly damaging Het
Ctla2a T A 13: 60,936,528 M2L unknown Het
Cyp3a57 A T 5: 145,349,329 Y25F probably benign Het
Dicer1 C T 12: 104,731,038 V87M possibly damaging Het
Dnah3 A T 7: 120,045,689 I1123N probably damaging Het
Fam212a T A 9: 107,984,893 K75* probably null Het
Fkbp10 G T 11: 100,416,000 E73* probably null Het
Flnb C A 14: 7,904,665 H1023N probably benign Het
Gapvd1 T A 2: 34,723,014 Q312H Het
Gm14025 A T 2: 129,036,918 D1029E unknown Het
Htr1d A T 4: 136,443,578 I373F probably benign Het
Inhba G A 13: 16,026,771 R306H probably damaging Het
Iqcg A T 16: 33,040,877 D156E probably benign Het
Ireb2 C A 9: 54,906,637 T798K probably damaging Het
Klk8 G A 7: 43,802,181 A199T probably damaging Het
Lgi2 T C 5: 52,554,433 T182A probably benign Het
Ltbp2 C A 12: 84,853,864 R228L probably damaging Het
Lyrm1 A G 7: 119,909,867 K22E possibly damaging Het
Mybbp1a A G 11: 72,449,071 D967G probably benign Het
Nr6a1 C T 2: 38,740,473 R259Q probably benign Het
Olfr1509 A G 14: 52,450,472 N20D probably benign Het
Olfr611 T C 7: 103,518,239 I48M probably benign Het
Olfr640 C A 7: 104,021,491 V276F probably damaging Het
Pak7 A T 2: 136,116,892 I92N probably damaging Het
Pcdhb5 T A 18: 37,321,611 I348K possibly damaging Het
Phf2 C T 13: 48,803,658 A1078T probably damaging Het
Rnf103 T C 6: 71,510,065 V560A probably benign Het
Slc27a4 A G 2: 29,811,596 I409V probably benign Het
Spata18 T A 5: 73,651,674 probably null Het
Spon1 A G 7: 114,033,076 T545A probably damaging Het
Stab1 A G 14: 31,155,765 S772P probably damaging Het
Stox2 A T 8: 47,192,269 S719T probably benign Het
Syne1 A G 10: 5,030,394 V864A probably benign Het
Syngap1 A G 17: 26,961,605 S836G probably benign Het
Tiparp G T 3: 65,532,156 E298* probably null Het
Tmem52 A G 4: 155,470,158 T114A probably damaging Het
Trim36 C A 18: 46,196,214 C53F probably damaging Het
Ttn C A 2: 76,885,124 probably null Het
Ttn T C 2: 76,890,467 K6871R unknown Het
Ube2d1 T C 10: 71,262,264 probably null Het
Unc13c T C 9: 73,931,542 T676A probably benign Het
Vps13a A T 19: 16,742,544 Y417N possibly damaging Het
Zfp729a C T 13: 67,619,554 C852Y probably damaging Het
Other mutations in Brca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Brca1 APN 11 101524369 missense possibly damaging 0.71
IGL01598:Brca1 APN 11 101524330 missense probably benign 0.04
IGL01744:Brca1 APN 11 101524176 missense possibly damaging 0.73
IGL02128:Brca1 APN 11 101530982 unclassified probably benign
IGL02377:Brca1 APN 11 101524323 missense probably benign 0.01
IGL02701:Brca1 APN 11 101525235 missense probably damaging 1.00
IGL02732:Brca1 APN 11 101492219 missense probably benign 0.07
IGL02935:Brca1 APN 11 101489867 missense probably benign 0.00
IGL02940:Brca1 APN 11 101489912 missense probably benign 0.00
IGL03198:Brca1 APN 11 101512711 splice site probably benign
BB002:Brca1 UTSW 11 101508146 missense probably benign 0.01
BB009:Brca1 UTSW 11 101540017 missense possibly damaging 0.85
BB012:Brca1 UTSW 11 101508146 missense probably benign 0.01
BB019:Brca1 UTSW 11 101540017 missense possibly damaging 0.85
PIT4142001:Brca1 UTSW 11 101522422 unclassified probably benign
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0144:Brca1 UTSW 11 101526121 missense probably damaging 1.00
R0336:Brca1 UTSW 11 101523993 missense probably benign 0.04
R0448:Brca1 UTSW 11 101508221 missense possibly damaging 0.93
R0595:Brca1 UTSW 11 101524887 missense probably benign 0.27
R0613:Brca1 UTSW 11 101508210 missense probably benign 0.18
R0863:Brca1 UTSW 11 101524770 missense probably benign 0.36
R0940:Brca1 UTSW 11 101532143 missense possibly damaging 0.73
R0962:Brca1 UTSW 11 101525366 missense possibly damaging 0.46
R1365:Brca1 UTSW 11 101501996 missense probably benign
R1391:Brca1 UTSW 11 101526546 missense possibly damaging 0.53
R1467:Brca1 UTSW 11 101531107 unclassified probably benign
R1484:Brca1 UTSW 11 101529812 missense possibly damaging 0.86
R1530:Brca1 UTSW 11 101524695 missense probably damaging 1.00
R1645:Brca1 UTSW 11 101510053 missense probably benign 0.00
R1682:Brca1 UTSW 11 101525565 missense probably damaging 0.98
R1687:Brca1 UTSW 11 101489840 missense probably benign
R1694:Brca1 UTSW 11 101532099 missense probably damaging 0.98
R1695:Brca1 UTSW 11 101524455 missense probably damaging 0.97
R1762:Brca1 UTSW 11 101532018 critical splice donor site probably null
R1868:Brca1 UTSW 11 101498013 missense probably benign
R1973:Brca1 UTSW 11 101526403 missense probably benign 0.22
R2034:Brca1 UTSW 11 101489849 missense probably benign
R2106:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R4089:Brca1 UTSW 11 101524176 missense possibly damaging 0.73
R4194:Brca1 UTSW 11 101525287 missense probably benign 0.02
R4571:Brca1 UTSW 11 101517366 missense probably benign 0.00
R4735:Brca1 UTSW 11 101492175 splice site probably null
R4789:Brca1 UTSW 11 101523932 missense probably benign 0.00
R4920:Brca1 UTSW 11 101524959 missense probably damaging 1.00
R4939:Brca1 UTSW 11 101508050 missense probably benign
R4997:Brca1 UTSW 11 101524333 missense probably damaging 0.96
R5458:Brca1 UTSW 11 101517285 missense possibly damaging 0.53
R5778:Brca1 UTSW 11 101525301 missense possibly damaging 0.47
R6051:Brca1 UTSW 11 101524246 missense probably damaging 1.00
R6505:Brca1 UTSW 11 101523541 missense probably benign 0.03
R6548:Brca1 UTSW 11 101524765 missense probably damaging 1.00
R6971:Brca1 UTSW 11 101534005 missense probably benign 0.18
R7091:Brca1 UTSW 11 101526427 missense probably benign 0.00
R7246:Brca1 UTSW 11 101523378 missense probably benign 0.00
R7417:Brca1 UTSW 11 101524981 missense probably damaging 1.00
R7861:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R7925:Brca1 UTSW 11 101508146 missense probably benign 0.01
R7932:Brca1 UTSW 11 101540017 missense possibly damaging 0.85
R8003:Brca1 UTSW 11 101524477 missense probably benign 0.22
R8046:Brca1 UTSW 11 101525470 missense probably benign 0.03
R8306:Brca1 UTSW 11 101525637 missense probably damaging 1.00
R8483:Brca1 UTSW 11 101525976 missense probably damaging 0.99
R8685:Brca1 UTSW 11 101489846 missense probably benign 0.19
R9072:Brca1 UTSW 11 101502480 critical splice donor site probably null
R9073:Brca1 UTSW 11 101502480 critical splice donor site probably null
R9486:Brca1 UTSW 11 101523694 missense probably benign 0.00
R9616:Brca1 UTSW 11 101525857 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAATCTAAGCTCACTGCACG -3'
(R):5'- AGATGACAGTCCTGTTACACAG -3'

Sequencing Primer
(F):5'- AACTCAGGGCCCCATGTTTG -3'
(R):5'- AGATGAGTTTGATTGTCATAGATTGC -3'
Posted On 2022-07-18