Incidental Mutation 'R9505:Olfr1509'
ID 717798
Institutional Source Beutler Lab
Gene Symbol Olfr1509
Ensembl Gene ENSMUSG00000035626
Gene Name olfactory receptor 1509
Synonyms MOR244-3, MOR83, GA_x6K02T2RJGY-534312-533386
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.425) question?
Stock # R9505 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 52442990-52452574 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 52450472 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 20 (N20D)
Ref Sequence ENSEMBL: ENSMUSP00000145819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045066] [ENSMUST00000205900] [ENSMUST00000206100] [ENSMUST00000206437] [ENSMUST00000206718] [ENSMUST00000215030]
AlphaFold Q7TQQ0
Predicted Effect probably benign
Transcript: ENSMUST00000045066
AA Change: N20D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046688
Gene: ENSMUSG00000035626
AA Change: N20D

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.3e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 301 3.3e-6 PFAM
Pfam:7tm_1 41 287 6.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205900
AA Change: N20D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206100
AA Change: N20D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206437
AA Change: N20D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206718
AA Change: N20D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215030
AA Change: N20D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,329,354 M1V probably null Het
4931406P16Rik A T 7: 34,284,946 L84Q probably damaging Het
9530053A07Rik A T 7: 28,142,484 K615* probably null Het
Ablim1 A G 19: 57,197,350 probably benign Het
Adamts17 A C 7: 67,124,935 N961T probably benign Het
Adamts3 G A 5: 89,707,892 T373I probably damaging Het
Bcan G A 3: 87,993,441 P495L probably benign Het
Bicd1 A C 6: 149,484,024 E85A probably benign Het
Brca1 G T 11: 101,512,766 H1437N probably benign Het
Camk2n1 T C 4: 138,455,256 I24T possibly damaging Het
Ces2f T A 8: 104,950,037 M121K probably benign Het
CN725425 T A 15: 91,240,664 Y136N possibly damaging Het
Ctla2a T A 13: 60,936,528 M2L unknown Het
Cyp3a57 A T 5: 145,349,329 Y25F probably benign Het
Dicer1 C T 12: 104,731,038 V87M possibly damaging Het
Dnah3 A T 7: 120,045,689 I1123N probably damaging Het
Fam212a T A 9: 107,984,893 K75* probably null Het
Fkbp10 G T 11: 100,416,000 E73* probably null Het
Flnb C A 14: 7,904,665 H1023N probably benign Het
Gapvd1 T A 2: 34,723,014 Q312H Het
Gm14025 A T 2: 129,036,918 D1029E unknown Het
Htr1d A T 4: 136,443,578 I373F probably benign Het
Inhba G A 13: 16,026,771 R306H probably damaging Het
Iqcg A T 16: 33,040,877 D156E probably benign Het
Ireb2 C A 9: 54,906,637 T798K probably damaging Het
Klk8 G A 7: 43,802,181 A199T probably damaging Het
Lgi2 T C 5: 52,554,433 T182A probably benign Het
Ltbp2 C A 12: 84,853,864 R228L probably damaging Het
Lyrm1 A G 7: 119,909,867 K22E possibly damaging Het
Mybbp1a A G 11: 72,449,071 D967G probably benign Het
Nr6a1 C T 2: 38,740,473 R259Q probably benign Het
Olfr611 T C 7: 103,518,239 I48M probably benign Het
Olfr640 C A 7: 104,021,491 V276F probably damaging Het
Pak7 A T 2: 136,116,892 I92N probably damaging Het
Pcdhb5 T A 18: 37,321,611 I348K possibly damaging Het
Phf2 C T 13: 48,803,658 A1078T probably damaging Het
Rnf103 T C 6: 71,510,065 V560A probably benign Het
Slc27a4 A G 2: 29,811,596 I409V probably benign Het
Spata18 T A 5: 73,651,674 probably null Het
Spon1 A G 7: 114,033,076 T545A probably damaging Het
Stab1 A G 14: 31,155,765 S772P probably damaging Het
Stox2 A T 8: 47,192,269 S719T probably benign Het
Syne1 A G 10: 5,030,394 V864A probably benign Het
Syngap1 A G 17: 26,961,605 S836G probably benign Het
Tiparp G T 3: 65,532,156 E298* probably null Het
Tmem52 A G 4: 155,470,158 T114A probably damaging Het
Trim36 C A 18: 46,196,214 C53F probably damaging Het
Ttn C A 2: 76,885,124 probably null Het
Ttn T C 2: 76,890,467 K6871R unknown Het
Ube2d1 T C 10: 71,262,264 probably null Het
Unc13c T C 9: 73,931,542 T676A probably benign Het
Vps13a A T 19: 16,742,544 Y417N possibly damaging Het
Zfp729a C T 13: 67,619,554 C852Y probably damaging Het
Other mutations in Olfr1509
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Olfr1509 APN 14 52451027 missense probably benign 0.00
IGL01694:Olfr1509 APN 14 52450584 missense probably benign
IGL02656:Olfr1509 APN 14 52450709 missense possibly damaging 0.60
R0244:Olfr1509 UTSW 14 52450512 missense probably benign 0.00
R1249:Olfr1509 UTSW 14 52450522 missense probably benign
R1601:Olfr1509 UTSW 14 52450442 missense probably benign 0.00
R1717:Olfr1509 UTSW 14 52450839 missense probably benign 0.00
R1953:Olfr1509 UTSW 14 52450887 missense probably benign 0.00
R4689:Olfr1509 UTSW 14 52451214 missense probably benign
R4943:Olfr1509 UTSW 14 52450594 nonsense probably null
R6223:Olfr1509 UTSW 14 52450679 missense probably benign 0.00
R6516:Olfr1509 UTSW 14 52451129 missense probably damaging 1.00
R7323:Olfr1509 UTSW 14 52451213 missense probably benign 0.00
R7507:Olfr1509 UTSW 14 52450473 missense probably benign 0.00
R7674:Olfr1509 UTSW 14 52450442 missense probably benign 0.00
R9010:Olfr1509 UTSW 14 52451099 missense possibly damaging 0.82
Z1088:Olfr1509 UTSW 14 52451209 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATATTCATGCCAAGCCTCAAAG -3'
(R):5'- GCTGTGCAATGCAATTGTCAAAG -3'

Sequencing Primer
(F):5'- GCCTCAAAGAAAAACAGTCATTTC -3'
(R):5'- TCAAGCATCTTGGGCACG -3'
Posted On 2022-07-18