Mutagenetix > Incidental Mutation

Incidental Mutation 'R9506:Rap1gap2'

717838

Institutional Source

Beutler Lab

Gene Symbol

Rap1gap2

Ensembl Gene

ENSMUSG00000038807

Gene Name

RAP1 GTPase activating protein 2

Synonyms

Garnl4, LOC380710

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9506 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

74383356-74610915 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74414440 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 313 (M313T)

Ref Sequence

ENSEMBL: ENSMUSP00000099580 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047488] [ENSMUST00000102521]

AlphaFold

Q5SVL6

Predicted Effect

probably damaging
Transcript: ENSMUST00000047488
AA Change: M373T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000040180
Gene: ENSMUSG00000038807
AA Change: M373T

Domain	Start	End	E-Value	Type
Pfam:Rap_GAP	258	445	1.2e-64	PFAM
low complexity region	617	629	N/A	INTRINSIC
low complexity region	660	669	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102521
AA Change: M313T

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099580
Gene: ENSMUSG00000038807
AA Change: M313T

Domain	Start	End	E-Value	Type
Pfam:Rap_GAP	258	439	4.9e-67	PFAM
low complexity region	617	629	N/A	INTRINSIC
low complexity region	660	669	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein that activates the small guanine-nucleotide-binding protein Rap1 in platelets. The protein interacts with synaptotagmin-like protein 1 and Rab27 and regulates secretion of dense granules from platelets at sites of endothelial damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	A	G	16: 56,617,410	T632A	unknown	Het
Atp2b1	T	C	10: 99,023,000	S1182P	probably benign	Het
Best3	T	A	10: 117,003,921	F225I	probably damaging	Het
Camk1g	A	G	1: 193,348,055		probably null	Het
Cdc42bpb	G	A	12: 111,294,938	P1656S	probably benign	Het
Cflar	A	T	1: 58,752,816	Q426L		Het
Chrna9	T	A	5: 65,970,870	D140E	probably damaging	Het
Cmpk2	A	G	12: 26,469,851	D167G	probably benign	Het
Csmd1	A	G	8: 16,200,009	L985P	probably damaging	Het
Cutal	A	G	2: 34,885,882	D75G	probably null	Het
Dnah12	G	T	14: 26,792,211	V1776F	probably benign	Het
Dnah6	A	G	6: 73,142,316	V1528A	probably damaging	Het
Elovl1	A	G	4: 118,430,715	D16G	probably damaging	Het
Ermard	T	A	17: 15,061,106	L593M	probably damaging	Het
Fstl4	A	G	11: 53,134,123	D274G	probably benign	Het
Gabrg1	C	T	5: 70,782,370	V140M	probably damaging	Het
Glrx2	C	T	1: 143,746,532	R89*	probably null	Het
Gsta3	A	C	1: 21,257,362	D40A	possibly damaging	Het
Hist1h4c	C	T	13: 23,698,281	G57S	probably benign	Het
Hsf2	G	A	10: 57,505,145		probably null	Het
Ifi203	A	G	1: 173,923,999	S833P	possibly damaging	Het
Ilk	T	C	7: 105,740,813	Y132H	probably benign	Het
Jup	G	A	11: 100,376,878	R540C	probably damaging	Het
Kdm7a	T	A	6: 39,149,371	H560L	probably benign	Het
Kynu	T	A	2: 43,681,402	N443K	probably damaging	Het
Mbd5	T	C	2: 49,272,907	S1134P	probably damaging	Het
Mknk2	T	C	10: 80,668,084	D331G	probably benign	Het
Mtfmt	C	T	9: 65,435,865	R18C	probably benign	Het
Myo5b	A	G	18: 74,744,760	Q1584R	possibly damaging	Het
Nup210	G	A	6: 91,071,874	P467S	possibly damaging	Het
Nxf1	A	G	19: 8,772,144	Y135C	probably damaging	Het
Olfr1200	T	C	2: 88,767,496	Y273C	probably damaging	Het
Rab11fip3	T	G	17: 25,994,276	E853A	probably damaging	Het
Rims2	G	A	15: 39,472,436	V814I	probably damaging	Het
Sec16a	A	T	2: 26,429,372		probably null	Het
Slc36a3	A	G	11: 55,148,631	I57T	probably benign	Het
Slc5a9	G	A	4: 111,893,242	R140*	probably null	Het
Tas2r131	T	A	6: 132,957,061	T262S	possibly damaging	Het
Tigd3	G	T	19: 5,892,832	A90D	probably damaging	Het
Txnrd3	A	G	6: 89,661,479	M217V	possibly damaging	Het
Ube2cbp	A	G	9: 86,448,772	I119T	probably damaging	Het
Vcp	A	G	4: 42,983,383	V559A	probably damaging	Het
Vmn1r173	T	A	7: 23,702,538	I66N	probably damaging	Het
Vmn1r234	T	G	17: 21,229,241	I139S	probably benign	Het
Vmn2r105	C	T	17: 20,209,142	M557I	probably benign	Het
Wnt7b	A	G	15: 85,581,412	S22P	unknown	Het
Zfp850	C	A	7: 27,989,562	R407L	possibly damaging	Het

Other mutations in Rap1gap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00687:Rap1gap2	APN	11	74416259	missense	probably benign	0.25
IGL00839:Rap1gap2	APN	11	74437448	missense	probably damaging	1.00
IGL02301:Rap1gap2	APN	11	74407369	missense	probably damaging	1.00
IGL02367:Rap1gap2	APN	11	74397355	critical splice donor site	probably null
IGL02832:Rap1gap2	APN	11	74412455	splice site	probably benign
IGL03067:Rap1gap2	APN	11	74393412	missense	possibly damaging	0.63
IGL03341:Rap1gap2	APN	11	74435714	missense	probably damaging	1.00
IGL03355:Rap1gap2	APN	11	74412344	missense	probably damaging	1.00
drummerboy	UTSW	11	74407372	missense	probably damaging	1.00
magister	UTSW	11	74435761	nonsense	probably null
P0026:Rap1gap2	UTSW	11	74567210	splice site	probably benign
R0106:Rap1gap2	UTSW	11	74435744	missense	probably benign	0.10
R0106:Rap1gap2	UTSW	11	74435744	missense	probably benign	0.10
R0514:Rap1gap2	UTSW	11	74388854	missense	possibly damaging	0.74
R0518:Rap1gap2	UTSW	11	74441766	missense	probably damaging	1.00
R0521:Rap1gap2	UTSW	11	74441766	missense	probably damaging	1.00
R1070:Rap1gap2	UTSW	11	74437027	missense	possibly damaging	0.71
R1467:Rap1gap2	UTSW	11	74437027	missense	possibly damaging	0.71
R1467:Rap1gap2	UTSW	11	74437027	missense	possibly damaging	0.71
R1998:Rap1gap2	UTSW	11	74395833	missense	probably benign	0.04
R2144:Rap1gap2	UTSW	11	74425976	missense	probably damaging	1.00
R2145:Rap1gap2	UTSW	11	74425976	missense	probably damaging	1.00
R2180:Rap1gap2	UTSW	11	74393146	missense	probably benign	0.24
R2938:Rap1gap2	UTSW	11	74407322	missense	possibly damaging	0.71
R2991:Rap1gap2	UTSW	11	74407322	missense	possibly damaging	0.71
R2992:Rap1gap2	UTSW	11	74407322	missense	possibly damaging	0.71
R2993:Rap1gap2	UTSW	11	74407322	missense	possibly damaging	0.71
R3033:Rap1gap2	UTSW	11	74407322	missense	possibly damaging	0.71
R3035:Rap1gap2	UTSW	11	74407322	missense	possibly damaging	0.71
R3686:Rap1gap2	UTSW	11	74407322	missense	possibly damaging	0.71
R4426:Rap1gap2	UTSW	11	74407322	missense	possibly damaging	0.71
R4427:Rap1gap2	UTSW	11	74407322	missense	possibly damaging	0.71
R4621:Rap1gap2	UTSW	11	74435699	critical splice donor site	probably null
R4705:Rap1gap2	UTSW	11	74437439	missense	probably damaging	1.00
R4809:Rap1gap2	UTSW	11	74407974	splice site	probably benign
R5092:Rap1gap2	UTSW	11	74438295	missense	probably damaging	1.00
R5283:Rap1gap2	UTSW	11	74395825	missense	probably damaging	1.00
R5343:Rap1gap2	UTSW	11	74441785	missense	probably damaging	0.99
R5941:Rap1gap2	UTSW	11	74392237	missense	probably damaging	1.00
R6414:Rap1gap2	UTSW	11	74405790	missense	probably damaging	1.00
R6647:Rap1gap2	UTSW	11	74407928	missense	probably benign	0.04
R6951:Rap1gap2	UTSW	11	74484948	missense	possibly damaging	0.81
R7096:Rap1gap2	UTSW	11	74392231	missense	probably damaging	0.99
R7107:Rap1gap2	UTSW	11	74393119	missense	probably damaging	1.00
R7397:Rap1gap2	UTSW	11	74414411	missense	probably benign	0.28
R7553:Rap1gap2	UTSW	11	74435722	missense	probably damaging	0.97
R8038:Rap1gap2	UTSW	11	74392283	missense	probably benign	0.00
R8051:Rap1gap2	UTSW	11	74395825	missense	probably damaging	0.97
R8466:Rap1gap2	UTSW	11	74425231	missense	probably benign	0.33
R8772:Rap1gap2	UTSW	11	74405725	missense	probably damaging	1.00
R8853:Rap1gap2	UTSW	11	74407372	missense	probably damaging	1.00
R8914:Rap1gap2	UTSW	11	74435761	nonsense	probably null
R9600:Rap1gap2	UTSW	11	74393128	missense	probably benign	0.01
Z1176:Rap1gap2	UTSW	11	74610877	frame shift	probably null
Z1186:Rap1gap2	UTSW	11	74596895	missense	probably benign	0.41
Z1187:Rap1gap2	UTSW	11	74596895	missense	probably benign	0.41
Z1188:Rap1gap2	UTSW	11	74596895	missense	probably benign	0.41
Z1189:Rap1gap2	UTSW	11	74596895	missense	probably benign	0.41
Z1190:Rap1gap2	UTSW	11	74596895	missense	probably benign	0.41
Z1191:Rap1gap2	UTSW	11	74596895	missense	probably benign	0.41
Z1192:Rap1gap2	UTSW	11	74596895	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- CTTCATTGACTTCCCAGGGG -3'
(R):5'- ATACCCTTGTTGGCCCTCAG -3'

Sequencing Primer
(F):5'- CGTTGATACTAGAGATAGAGCCC -3'
(R):5'- GTTGGCCCTCAGCTCATC -3'

Posted On

2022-07-18