Mutagenetix > Incidental Mutation

Incidental Mutation 'R9506:Rab11fip3'

717850

Institutional Source

Beutler Lab

Gene Symbol

Rab11fip3

Ensembl Gene

ENSMUSG00000037098

Gene Name

RAB11 family interacting protein 3 (class II)

Synonyms

D030060O14Rik, Rab11-FIP3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9506 (G1)

Quality Score

182.009

Status

Not validated

Chromosome

Chromosomal Location

25989036-26069409 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 25994276 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Alanine at position 853 (E853A)

Ref Sequence

ENSEMBL: ENSMUSP00000113521 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118828] [ENSMUST00000120691] [ENSMUST00000122103]

AlphaFold

Q8CHD8

Predicted Effect

probably damaging
Transcript: ENSMUST00000118828
AA Change: E205A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000113048
Gene: ENSMUSG00000037098
AA Change: E205A

Domain	Start	End	E-Value	Type
low complexity region	136	148	N/A	INTRINSIC
low complexity region	313	333	N/A	INTRINSIC
Blast:BRLZ	335	385	2e-11	BLAST
Pfam:RBD-FIP	404	444	2.8e-18	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000120691
AA Change: E808A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000112875
Gene: ENSMUSG00000037098
AA Change: E808A

Domain	Start	End	E-Value	Type
internal_repeat_1	29	130	3.12e-31	PROSPERO
internal_repeat_1	144	294	3.12e-31	PROSPERO
EFh	500	528	3.03e-1	SMART
EFh	532	560	3.86e1	SMART
low complexity region	739	751	N/A	INTRINSIC
low complexity region	916	936	N/A	INTRINSIC
Blast:BRLZ	938	988	2e-11	BLAST
Pfam:RBD-FIP	1007	1047	4.7e-18	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000122103
AA Change: E853A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113521
Gene: ENSMUSG00000037098
AA Change: E853A

Domain	Start	End	E-Value	Type
internal_repeat_1	29	130	2.03e-32	PROSPERO
internal_repeat_1	144	294	2.03e-32	PROSPERO
EFh	500	528	3.03e-1	SMART
EFh	532	560	3.86e1	SMART
low complexity region	784	796	N/A	INTRINSIC
low complexity region	961	981	N/A	INTRINSIC
Blast:BRLZ	983	1033	2e-11	BLAST
Pfam:RBD-FIP	1052	1092	4.9e-18	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the large Rab GTPase family (see RAB1A; MIM 179508) have regulatory roles in the formation, targeting, and fusion of intracellular transport vesicles. RAB11FIP3 is one of many proteins that interact with and regulate Rab GTPases (Hales et al., 2001 [PubMed 11495908]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	A	G	16: 56,617,410	T632A	unknown	Het
Atp2b1	T	C	10: 99,023,000	S1182P	probably benign	Het
Best3	T	A	10: 117,003,921	F225I	probably damaging	Het
Camk1g	A	G	1: 193,348,055		probably null	Het
Cdc42bpb	G	A	12: 111,294,938	P1656S	probably benign	Het
Cflar	A	T	1: 58,752,816	Q426L		Het
Chrna9	T	A	5: 65,970,870	D140E	probably damaging	Het
Cmpk2	A	G	12: 26,469,851	D167G	probably benign	Het
Csmd1	A	G	8: 16,200,009	L985P	probably damaging	Het
Cutal	A	G	2: 34,885,882	D75G	probably null	Het
Dnah12	G	T	14: 26,792,211	V1776F	probably benign	Het
Dnah6	A	G	6: 73,142,316	V1528A	probably damaging	Het
Elovl1	A	G	4: 118,430,715	D16G	probably damaging	Het
Ermard	T	A	17: 15,061,106	L593M	probably damaging	Het
Fstl4	A	G	11: 53,134,123	D274G	probably benign	Het
Gabrg1	C	T	5: 70,782,370	V140M	probably damaging	Het
Glrx2	C	T	1: 143,746,532	R89*	probably null	Het
Gsta3	A	C	1: 21,257,362	D40A	possibly damaging	Het
Hist1h4c	C	T	13: 23,698,281	G57S	probably benign	Het
Hsf2	G	A	10: 57,505,145		probably null	Het
Ifi203	A	G	1: 173,923,999	S833P	possibly damaging	Het
Ilk	T	C	7: 105,740,813	Y132H	probably benign	Het
Jup	G	A	11: 100,376,878	R540C	probably damaging	Het
Kdm7a	T	A	6: 39,149,371	H560L	probably benign	Het
Kynu	T	A	2: 43,681,402	N443K	probably damaging	Het
Mbd5	T	C	2: 49,272,907	S1134P	probably damaging	Het
Mknk2	T	C	10: 80,668,084	D331G	probably benign	Het
Mtfmt	C	T	9: 65,435,865	R18C	probably benign	Het
Myo5b	A	G	18: 74,744,760	Q1584R	possibly damaging	Het
Nup210	G	A	6: 91,071,874	P467S	possibly damaging	Het
Nxf1	A	G	19: 8,772,144	Y135C	probably damaging	Het
Olfr1200	T	C	2: 88,767,496	Y273C	probably damaging	Het
Rap1gap2	A	G	11: 74,414,440	M313T	probably damaging	Het
Rims2	G	A	15: 39,472,436	V814I	probably damaging	Het
Sec16a	A	T	2: 26,429,372		probably null	Het
Slc36a3	A	G	11: 55,148,631	I57T	probably benign	Het
Slc5a9	G	A	4: 111,893,242	R140*	probably null	Het
Tas2r131	T	A	6: 132,957,061	T262S	possibly damaging	Het
Tigd3	G	T	19: 5,892,832	A90D	probably damaging	Het
Txnrd3	A	G	6: 89,661,479	M217V	possibly damaging	Het
Ube2cbp	A	G	9: 86,448,772	I119T	probably damaging	Het
Vcp	A	G	4: 42,983,383	V559A	probably damaging	Het
Vmn1r173	T	A	7: 23,702,538	I66N	probably damaging	Het
Vmn1r234	T	G	17: 21,229,241	I139S	probably benign	Het
Vmn2r105	C	T	17: 20,209,142	M557I	probably benign	Het
Wnt7b	A	G	15: 85,581,412	S22P	unknown	Het
Zfp850	C	A	7: 27,989,562	R407L	possibly damaging	Het

Other mutations in Rab11fip3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Rab11fip3	APN	17	25991809	splice site	probably benign
IGL00420:Rab11fip3	APN	17	26067625	missense	probably benign	0.20
IGL01291:Rab11fip3	APN	17	26016113	missense	probably damaging	0.99
IGL01473:Rab11fip3	APN	17	26068735	missense	possibly damaging	0.53
IGL01687:Rab11fip3	APN	17	26067982	missense	probably damaging	0.97
IGL01764:Rab11fip3	APN	17	26068693	missense	probably benign	0.02
IGL01977:Rab11fip3	APN	17	26068003	missense	possibly damaging	0.72
IGL02140:Rab11fip3	APN	17	26067892	missense	probably benign	0.33
IGL02434:Rab11fip3	APN	17	26068835	missense	possibly damaging	0.85
IGL02549:Rab11fip3	APN	17	25994320	missense	probably damaging	0.96
IGL02889:Rab11fip3	APN	17	26067679	missense	possibly damaging	0.84
IGL02953:Rab11fip3	APN	17	26067679	missense	possibly damaging	0.84
ANU05:Rab11fip3	UTSW	17	26016113	missense	probably damaging	0.99
R0193:Rab11fip3	UTSW	17	25990999	missense	probably damaging	0.99
R0388:Rab11fip3	UTSW	17	26069072	missense	probably benign	0.33
R0543:Rab11fip3	UTSW	17	25994225	missense	probably damaging	1.00
R0678:Rab11fip3	UTSW	17	26068847	missense	probably benign	0.00
R1283:Rab11fip3	UTSW	17	26004554	missense	probably damaging	1.00
R1473:Rab11fip3	UTSW	17	25991322	missense	probably damaging	1.00
R1625:Rab11fip3	UTSW	17	26068891	missense	possibly damaging	0.72
R1973:Rab11fip3	UTSW	17	26024391	missense	probably damaging	0.97
R2160:Rab11fip3	UTSW	17	26069054	missense	probably benign	0.33
R2197:Rab11fip3	UTSW	17	26068178	missense	probably benign
R2382:Rab11fip3	UTSW	17	25990867	nonsense	probably null
R3028:Rab11fip3	UTSW	17	26015942	critical splice donor site	probably null
R3797:Rab11fip3	UTSW	17	26068526	missense	possibly damaging	0.73
R4012:Rab11fip3	UTSW	17	26068028	frame shift	probably null
R4064:Rab11fip3	UTSW	17	26024394	missense	probably damaging	0.97
R4478:Rab11fip3	UTSW	17	26016083	missense	probably damaging	1.00
R4527:Rab11fip3	UTSW	17	26036657	missense	probably damaging	1.00
R4565:Rab11fip3	UTSW	17	26068706	missense	possibly damaging	0.73
R5048:Rab11fip3	UTSW	17	26067580	critical splice donor site	probably null
R5138:Rab11fip3	UTSW	17	25991026	missense	probably benign	0.32
R5317:Rab11fip3	UTSW	17	26068078	missense	possibly damaging	0.72
R5453:Rab11fip3	UTSW	17	25992581	critical splice donor site	probably null
R5495:Rab11fip3	UTSW	17	26016143	missense	probably damaging	0.99
R5525:Rab11fip3	UTSW	17	25991295	missense	probably damaging	1.00
R5654:Rab11fip3	UTSW	17	26016064	missense	probably damaging	1.00
R5716:Rab11fip3	UTSW	17	26036664	missense	probably damaging	1.00
R5818:Rab11fip3	UTSW	17	26016116	missense	probably damaging	1.00
R6044:Rab11fip3	UTSW	17	26067869	missense	possibly damaging	0.93
R6716:Rab11fip3	UTSW	17	25991057	missense	probably damaging	1.00
R6785:Rab11fip3	UTSW	17	25991718	missense	probably damaging	0.99
R7161:Rab11fip3	UTSW	17	26069090	missense	probably benign	0.09
R7390:Rab11fip3	UTSW	17	26068152	missense	possibly damaging	0.81
R7447:Rab11fip3	UTSW	17	26068874	missense	possibly damaging	0.66
R7836:Rab11fip3	UTSW	17	26068258	missense	possibly damaging	0.82
R7981:Rab11fip3	UTSW	17	25997989	missense	probably damaging	0.98
R8008:Rab11fip3	UTSW	17	26067982	missense	probably damaging	0.97
R8887:Rab11fip3	UTSW	17	26067953	missense	possibly damaging	0.83
R8962:Rab11fip3	UTSW	17	26012033	missense	probably damaging	1.00
R9250:Rab11fip3	UTSW	17	26018245	missense	unknown
R9329:Rab11fip3	UTSW	17	26012058	missense	probably benign	0.15

Predicted Primers

PCR Primer
(F):5'- AGCATCTTTTCATGTGAGTATCCC -3'
(R):5'- TGTTGCCCAAAACTTTCTGGC -3'

Sequencing Primer
(F):5'- TGTCCTGGAACTCTGTAGACCAG -3'
(R):5'- AAAACTTTCTGGCTCTTTCTTCAGG -3'

Posted On

2022-07-18