Incidental Mutation 'R9507:Ccdc191'
ID 717901
Institutional Source Beutler Lab
Gene Symbol Ccdc191
Ensembl Gene ENSMUSG00000022701
Gene Name coiled-coil domain containing 191
Synonyms 2610015P09Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock # R9507 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 43889800-43964314 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43943829 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 551 (L551P)
Ref Sequence ENSEMBL: ENSMUSP00000137597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132859] [ENSMUST00000178400]
AlphaFold J3QQ27
Predicted Effect
SMART Domains Protein: ENSMUSP00000113814
Gene: ENSMUSG00000022701
AA Change: L136P

DomainStartEndE-ValueType
coiled coil region 114 147 N/A INTRINSIC
coiled coil region 211 284 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132859
AA Change: L493P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116078
Gene: ENSMUSG00000022701
AA Change: L493P

DomainStartEndE-ValueType
coiled coil region 144 183 N/A INTRINSIC
coiled coil region 217 237 N/A INTRINSIC
coiled coil region 278 308 N/A INTRINSIC
low complexity region 349 368 N/A INTRINSIC
coiled coil region 471 504 N/A INTRINSIC
coiled coil region 568 641 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178400
AA Change: L551P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137597
Gene: ENSMUSG00000022701
AA Change: L551P

DomainStartEndE-ValueType
coiled coil region 202 241 N/A INTRINSIC
coiled coil region 275 295 N/A INTRINSIC
coiled coil region 336 366 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
coiled coil region 529 562 N/A INTRINSIC
coiled coil region 626 699 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik A G 19: 8,889,223 T47A probably damaging Het
Acsm2 A T 7: 119,580,716 I386F probably benign Het
Actn4 A T 7: 28,906,972 D305E probably benign Het
Anln A G 9: 22,362,840 V567A probably damaging Het
Arhgap35 A G 7: 16,563,418 I574T probably benign Het
Baz1b C A 5: 135,205,117 S166Y probably damaging Het
Cdk5rap2 T C 4: 70,291,873 T713A probably benign Het
Cep290 C A 10: 100,494,923 A155E possibly damaging Het
Chst8 G A 7: 34,748,071 Q41* probably null Het
Cyp2j6 C A 4: 96,518,107 E476* probably null Het
Des T C 1: 75,366,790 V439A probably benign Het
Dimt1 A G 13: 106,957,148 T283A probably benign Het
Dmxl1 T A 18: 49,891,500 V1747D possibly damaging Het
Fhod1 G A 8: 105,338,062 R137* probably null Het
Gab2 A T 7: 97,304,241 D608V probably damaging Het
Gdpd1 T C 11: 87,059,438 D103G possibly damaging Het
Hspa5 T C 2: 34,774,598 S355P probably benign Het
Ide A T 19: 37,288,137 F619L Het
Ifrd1 A C 12: 40,217,226 D70E probably benign Het
Il18r1 T A 1: 40,474,724 V30E probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcng1 A G 2: 168,269,232 L4S probably damaging Het
Lrfn4 A G 19: 4,614,329 F59S probably damaging Het
Lrrc15 T C 16: 30,274,011 D170G probably damaging Het
Mettl21e T A 1: 44,206,376 M237L probably benign Het
Myh1 A G 11: 67,211,223 K810E probably benign Het
Nbea T C 3: 55,665,590 D2524G probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nutm2 A T 13: 50,467,419 T7S probably benign Het
Olfr1355 A G 10: 78,879,763 H197R probably benign Het
Olfr1513 A T 14: 52,349,221 L275H probably damaging Het
Olfr331 T C 11: 58,501,750 T275A possibly damaging Het
Olfr420 T A 1: 174,158,986 I71K possibly damaging Het
Olfr448 G T 6: 42,896,901 C150F probably benign Het
Olfr635 T G 7: 103,979,991 F266L probably damaging Het
Pate4 A G 9: 35,608,242 S51P probably damaging Het
Rbm19 T C 5: 120,127,167 probably null Het
Rnf139 A G 15: 58,898,815 K230E probably damaging Het
Rpia G A 6: 70,777,393 Q134* probably null Het
Rsf1 GC GCGGCGGCGCC 7: 97,579,934 probably benign Het
Sbk2 G A 7: 4,957,278 P298S possibly damaging Het
Scrt1 A G 15: 76,519,092 S233P unknown Het
Sh2b1 CGGGGACCAGCTC CGGGGACCAGCTCAGCCAAGGGGACCAGCTC 7: 126,467,588 probably benign Het
Sppl2c T A 11: 104,187,327 Y318N probably benign Het
St6galnac4 G A 2: 32,595,727 W215* probably null Het
Stxbp6 A G 12: 45,019,577 L15P probably benign Het
Tmem104 T C 11: 115,200,873 L74P probably damaging Het
Tnfrsf10b A G 14: 69,777,772 D233G probably benign Het
Trmt11 A C 10: 30,558,942 Y369* probably null Het
Tusc1 T A 4: 93,335,008 H138L probably benign Het
Ush2a T A 1: 188,864,740 Y3892* probably null Het
Xirp2 A T 2: 67,513,936 I2174F possibly damaging Het
Zfp947 C T 17: 22,145,601 G364D probably benign Het
Other mutations in Ccdc191
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Ccdc191 APN 16 43959300 missense possibly damaging 0.81
IGL02272:Ccdc191 APN 16 43960022 missense possibly damaging 0.85
IGL02473:Ccdc191 APN 16 43956894 missense probably benign 0.03
IGL02660:Ccdc191 APN 16 43960099 missense probably benign 0.11
LCD18:Ccdc191 UTSW 16 43921801 intron probably benign
R0238:Ccdc191 UTSW 16 43947496 nonsense probably null
R0238:Ccdc191 UTSW 16 43947496 nonsense probably null
R0346:Ccdc191 UTSW 16 43938952 missense probably damaging 0.99
R0590:Ccdc191 UTSW 16 43931341 nonsense probably null
R0907:Ccdc191 UTSW 16 43915538 missense probably benign 0.03
R0930:Ccdc191 UTSW 16 43931255 missense probably damaging 1.00
R1761:Ccdc191 UTSW 16 43943510 missense probably benign 0.01
R2127:Ccdc191 UTSW 16 43908635 missense probably benign 0.00
R2408:Ccdc191 UTSW 16 43931198 missense probably benign 0.08
R2567:Ccdc191 UTSW 16 43943967 splice site probably null
R3104:Ccdc191 UTSW 16 43931210 missense probably damaging 1.00
R3105:Ccdc191 UTSW 16 43931210 missense probably damaging 1.00
R3106:Ccdc191 UTSW 16 43931210 missense probably damaging 1.00
R4319:Ccdc191 UTSW 16 43947509 missense probably damaging 1.00
R4320:Ccdc191 UTSW 16 43947509 missense probably damaging 1.00
R4323:Ccdc191 UTSW 16 43947509 missense probably damaging 1.00
R4324:Ccdc191 UTSW 16 43947509 missense probably damaging 1.00
R4667:Ccdc191 UTSW 16 43931283 missense probably damaging 1.00
R4676:Ccdc191 UTSW 16 43939173 splice site probably benign
R4788:Ccdc191 UTSW 16 43956822 missense probably damaging 1.00
R4976:Ccdc191 UTSW 16 43943505 missense probably benign 0.17
R5557:Ccdc191 UTSW 16 43908613 missense probably damaging 1.00
R6369:Ccdc191 UTSW 16 43915485 missense probably benign 0.05
R7459:Ccdc191 UTSW 16 43947457 nonsense probably null
R7543:Ccdc191 UTSW 16 43898209 nonsense probably null
R7843:Ccdc191 UTSW 16 43959336 missense probably damaging 1.00
R8077:Ccdc191 UTSW 16 43915605 critical splice donor site probably null
R8474:Ccdc191 UTSW 16 43889899 start gained probably benign
R8984:Ccdc191 UTSW 16 43890218 intron probably benign
R8987:Ccdc191 UTSW 16 43931347 missense probably benign 0.29
R9108:Ccdc191 UTSW 16 43898149 missense possibly damaging 0.92
R9222:Ccdc191 UTSW 16 43905468 missense probably damaging 1.00
R9276:Ccdc191 UTSW 16 43943678 nonsense probably null
R9448:Ccdc191 UTSW 16 43938975 missense
R9757:Ccdc191 UTSW 16 43941807 missense
Z1177:Ccdc191 UTSW 16 43939122 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GGTAATTGTCAGGGTCCTCTC -3'
(R):5'- AACACATTCCGAGTGCTGTG -3'

Sequencing Primer
(F):5'- AGATGTCTCTGGGAGCACAC -3'
(R):5'- GTGACCCTGCTGACATACTTCAG -3'
Posted On 2022-07-18